Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123676253:

Variant ID: vg0123676253 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23676253
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTCCCAAACTTCGGGCATGTTCACTTTGATGATATTTTCAACATTACCAAATTTTGGTAAAGTTATCAAAAAAAAAGTGGCTACATTTAGTTTGCTG[T/C]
TAAATTTTGGTACTATATAAGAAATCCTATCAAAATTTTGGCAAGTTGCTAAAATTTTAGCATAGTTGGTAAGGTTTTTTTTTGACATCAAAGTGAACAG

Reverse complement sequence

CTGTTCACTTTGATGTCAAAAAAAAACCTTACCAACTATGCTAAAATTTTAGCAACTTGCCAAAATTTTGATAGGATTTCTTATATAGTACCAAAATTTA[A/G]
CAGCAAACTAAATGTAGCCACTTTTTTTTTGATAACTTTACCAAAATTTGGTAATGTTGAAAATATCATCAAAGTGAACATGCCCGAAGTTTGGGAAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.50% 14.30% 19.47% 37.81% NA
All Indica  2759 8.60% 16.30% 28.16% 46.94% NA
All Japonica  1512 70.50% 7.90% 5.82% 15.74% NA
Aus  269 1.90% 3.00% 13.75% 81.41% NA
Indica I  595 9.60% 1.70% 52.77% 35.97% NA
Indica II  465 9.70% 4.90% 28.60% 56.77% NA
Indica III  913 4.90% 31.80% 11.28% 52.03% NA
Indica Intermediate  786 11.30% 16.30% 28.88% 43.51% NA
Temperate Japonica  767 91.70% 0.40% 3.13% 4.82% NA
Tropical Japonica  504 45.00% 16.90% 8.53% 29.56% NA
Japonica Intermediate  241 56.40% 13.30% 8.71% 21.58% NA
VI/Aromatic  96 7.30% 86.50% 2.08% 4.17% NA
Intermediate  90 34.40% 13.30% 17.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123676253 T -> DEL N N silent_mutation Average:80.169; most accessible tissue: Minghui63 flag leaf, score: 96.084 N N N N
vg0123676253 T -> C LOC_Os01g41810.1 upstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:80.169; most accessible tissue: Minghui63 flag leaf, score: 96.084 N N N N
vg0123676253 T -> C LOC_Os01g41810-LOC_Os01g41820 intergenic_region ; MODIFIER silent_mutation Average:80.169; most accessible tissue: Minghui63 flag leaf, score: 96.084 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123676253 T C -0.03 -0.02 -0.03 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123676253 NA 2.04E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 4.12E-06 4.12E-06 mr1473 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 7.14E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 9.33E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 9.78E-07 9.78E-07 mr1664 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 9.53E-08 mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 4.21E-08 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 6.46E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 2.27E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.11E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 3.09E-10 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.27E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.55E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 2.54E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.97E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.32E-10 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 2.48E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 2.43E-08 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123676253 NA 1.87E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251