Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123673583:

Variant ID: vg0123673583 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23673583
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCACCCGGATCCTTAGATGCCTTAGAGATCCCCTCAGAGAACCTCTCTGGTTTGAACTCATGCACGTCACTTCCCCAGATTTTCAGATCATGGTGGAT[G/A]
AACAGCACGGGAAGATTAATGATGACACCAGCAGGGTAAGTGACGCCTCCTATCTTCATCTCCTTGTATGTTCTCCGCTTAAGCTCGATGAACGGTGGGT

Reverse complement sequence

ACCCACCGTTCATCGAGCTTAAGCGGAGAACATACAAGGAGATGAAGATAGGAGGCGTCACTTACCCTGCTGGTGTCATCATTAATCTTCCCGTGCTGTT[C/T]
ATCCACCATGATCTGAAAATCTGGGGAAGTGACGTGCATGAGTTCAAACCAGAGAGGTTCTCTGAGGGGATCTCTAAGGCATCTAAGGATCCGGGTGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.80% 0.06% 0.00% NA
All Indica  2759 49.60% 50.30% 0.11% 0.00% NA
All Japonica  1512 91.20% 8.80% 0.00% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 14.80% 85.20% 0.00% 0.00% NA
Indica II  465 42.40% 57.60% 0.00% 0.00% NA
Indica III  913 77.30% 22.70% 0.00% 0.00% NA
Indica Intermediate  786 48.00% 51.70% 0.38% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 85.30% 14.70% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123673583 G -> A LOC_Os01g41810.1 synonymous_variant ; p.Phe439Phe; LOW synonymous_codon Average:64.466; most accessible tissue: Minghui63 flag leaf, score: 87.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123673583 G A -0.09 -0.03 -0.02 -0.03 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123673583 NA 1.15E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 4.43E-06 4.43E-06 mr1875 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 3.96E-06 NA mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 6.73E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 2.35E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 7.12E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 9.14E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 5.91E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 1.24E-12 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 7.23E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 3.00E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 5.75E-06 4.48E-14 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 2.76E-06 3.37E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 5.14E-06 2.63E-11 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 3.43E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 1.29E-06 4.30E-13 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 NA 1.83E-08 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123673583 9.64E-06 3.28E-12 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251