Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123525630:

Variant ID: vg0123525630 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23525630
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

GATCTACTATTTGTATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCCCGCATCTCATCAACCTTTGGTCCTGCACTGGAGCTAAGCAGATCTCC[C/T]
AAGCCGTTGTTGTTATCGACTAAGTCCGCGCCAACACAGATCCAGCACCATTGGCCAGGCGCGGGTTTTTCGATCAACACACTGATCACTACTTTCATGC

Reverse complement sequence

GCATGAAAGTAGTGATCAGTGTGTTGATCGAAAAACCCGCGCCTGGCCAATGGTGCTGGATCTGTGTTGGCGCGGACTTAGTCGATAACAACAACGGCTT[G/A]
GGAGATCTGCTTAGCTCCAGTGCAGGACCAAAGGTTGATGAGATGCGGGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATACAAATAGTAGATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	32.10%	0.32%	0.06%	NA
All Indica	2759	53.10%	46.40%	0.47%	0.04%	NA
All Japonica	1512	87.10%	12.80%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	11.80%	87.70%	0.50%	0.00%	NA
Indica II	465	42.80%	56.30%	0.65%	0.22%	NA
Indica III	913	84.70%	15.10%	0.22%	0.00%	NA
Indica Intermediate	786	53.80%	45.50%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	73.40%	26.60%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	23.70%	0.41%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	16.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123525630	C -> T	LOC_Os01g41560.1	upstream_gene_variant ; 2074.0bp to feature; MODIFIER	silent_mutation	Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0123525630	C -> T	LOC_Os01g41565.1	downstream_gene_variant ; 4459.0bp to feature; MODIFIER	silent_mutation	Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0123525630	C -> T	LOC_Os01g41560-LOC_Os01g41565	intergenic_region ; MODIFIER	silent_mutation	Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0123525630	C -> DEL	N	N	silent_mutation	Average:54.163; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123525630	NA	9.78E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	8.66E-10	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	5.40E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	1.73E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	4.24E-06	NA	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	4.19E-09	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	2.54E-06	NA	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	2.60E-10	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	1.06E-06	mr1996_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123525630	NA	1.36E-09	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251