Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123425063:

Variant ID: vg0123425063 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23425063
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTAGTTTTCTACTTTGACTGATTAATTTGTGGTATTAAACTTAGTTATTAACTTGTACCAATATTATAGTGAATTGCTTATGCTAAACATAGTTTA[C/T]
ATAATTTTTTCCATAAATTTTTCCATGATTTCATCTTGCATAGATTATTTTAAAGAATTAGAATAACATTTCTTTGTATATGTGTCCCTACTTCATAATT

Reverse complement sequence

AATTATGAAGTAGGGACACATATACAAAGAAATGTTATTCTAATTCTTTAAAATAATCTATGCAAGATGAAATCATGGAAAAATTTATGGAAAAAATTAT[G/A]
TAAACTATGTTTAGCATAAGCAATTCACTATAATATTGGTACAAGTTAATAACTAAGTTTAATACCACAAATTAATCAGTCAAAGTAGAAAACTAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	0.60%	8.65%	0.13%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	71.20%	1.90%	26.59%	0.40%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	74.60%	2.50%	22.69%	0.26%	NA
Tropical Japonica	504	57.30%	0.20%	41.67%	0.79%	NA
Japonica Intermediate	241	89.20%	3.30%	7.47%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	95.60%	0.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123425063	C -> T	LOC_Os01g41390.1	downstream_gene_variant ; 694.0bp to feature; MODIFIER	silent_mutation	Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0123425063	C -> T	LOC_Os01g41390-LOC_Os01g41400	intergenic_region ; MODIFIER	silent_mutation	Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0123425063	C -> DEL	N	N	silent_mutation	Average:26.067; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123425063	6.59E-07	5.02E-06	mr1114	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	8.59E-06	NA	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	2.41E-06	8.69E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	1.85E-06	1.48E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	8.54E-06	2.51E-07	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	7.64E-08	1.17E-07	mr1917	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123425063	2.15E-06	1.98E-07	mr1936	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251