Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123086310:

Variant ID: vg0123086310 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23086310
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCCAAAGCATGCTGGTTGGTGATTTGCAAGGACACTCTGCTTCATGGTTCTTTGACGAGGAATTAAATCCAGCCATTTGATCATGTTTGGCTTGTCAA[A/G]
AAATTAGGGCTAGTAAAATGTAATTTAGAGGAACCCATTATTGTTAGGGCATTACAACTATGCAATCGTTCTTCTGTTTGTCATTGCAAAATTGCTTTTT

Reverse complement sequence

AAAAAGCAATTTTGCAATGACAAACAGAAGAACGATTGCATAGTTGTAATGCCCTAACAATAATGGGTTCCTCTAAATTACATTTTACTAGCCCTAATTT[T/C]
TTGACAAGCCAAACATGATCAAATGGCTGGATTTAATTCCTCGTCAAAGAACCATGAAGCAGAGTGTCCTTGCAAATCACCAACCAGCATGCTTTGGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 23.90% 0.74% 16.57% NA
All Indica  2759 86.70% 6.50% 0.47% 6.34% NA
All Japonica  1512 5.40% 60.30% 1.06% 33.20% NA
Aus  269 92.90% 5.60% 0.74% 0.74% NA
Indica I  595 76.30% 15.50% 0.67% 7.56% NA
Indica II  465 95.50% 2.20% 0.22% 2.15% NA
Indica III  913 91.80% 1.90% 0.22% 6.13% NA
Indica Intermediate  786 83.50% 7.60% 0.76% 8.14% NA
Temperate Japonica  767 0.40% 86.80% 1.30% 11.47% NA
Tropical Japonica  504 13.90% 29.60% 0.20% 56.35% NA
Japonica Intermediate  241 3.70% 40.20% 2.07% 53.94% NA
VI/Aromatic  96 7.30% 1.00% 2.08% 89.58% NA
Intermediate  90 51.10% 26.70% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123086310 A -> G LOC_Os01g40840.1 upstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:44.303; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg0123086310 A -> G LOC_Os01g40840.2 upstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:44.303; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg0123086310 A -> G LOC_Os01g40830.1 intron_variant ; MODIFIER silent_mutation Average:44.303; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N
vg0123086310 A -> DEL N N silent_mutation Average:44.303; most accessible tissue: Zhenshan97 flower, score: 61.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123086310 NA 1.58E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 5.59E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 4.30E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 2.74E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 9.51E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 5.59E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 1.41E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 6.38E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 1.27E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 1.39E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 6.21E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 1.30E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 2.60E-08 mr1805_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123086310 NA 3.68E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251