Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122694201:

Variant ID: vg0122694201 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22694201
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.14, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AGCATGAGGGGGCGGAGGGAGAGGAGGGGCGGGGGAGAGTGAGAGAGAGCGAGAGTGAGAGAGATTTTGTGTAGGGTGGGGAGCGAGTATGGACAAGGAC[G/A]
GGACGCGTTTGGCTCGTCTTAGTTTTTCTGGTGTCATTTTTTTTAAAAAAAACCAATATTTATAATATAGGTGTCGGTTTTGTTTAAAATCGGCTCCTAT

Reverse complement sequence

ATAGGAGCCGATTTTAAACAAAACCGACACCTATATTATAAATATTGGTTTTTTTTAAAAAAAATGACACCAGAAAAACTAAGACGAGCCAAACGCGTCC[C/T]
GTCCTTGTCCATACTCGCTCCCCACCCTACACAAAATCTCTCTCACTCTCGCTCTCTCTCACTCTCCCCCGCCCCTCCTCTCCCTCCGCCCCCTCATGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	46.00%	0.40%	0.00%	NA
All Indica	2759	75.10%	24.50%	0.43%	0.00%	NA
All Japonica	1512	6.90%	93.10%	0.07%	0.00%	NA
Aus	269	90.30%	7.80%	1.86%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	63.20%	36.60%	0.22%	0.00%	NA
Indica III	913	66.30%	32.90%	0.88%	0.00%	NA
Indica Intermediate	786	75.40%	24.20%	0.38%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	18.80%	81.00%	0.20%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122694201	G -> A	LOC_Os01g40220.1	upstream_gene_variant ; 1080.0bp to feature; MODIFIER	silent_mutation	Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0122694201	G -> A	LOC_Os01g40230.1	upstream_gene_variant ; 4220.0bp to feature; MODIFIER	silent_mutation	Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0122694201	G -> A	LOC_Os01g40210.1	downstream_gene_variant ; 488.0bp to feature; MODIFIER	silent_mutation	Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0122694201	G -> A	LOC_Os01g40210-LOC_Os01g40220	intergenic_region ; MODIFIER	silent_mutation	Average:63.595; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122694201	NA	1.52E-11	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	8.20E-17	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	7.64E-06	1.96E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	4.25E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	8.81E-06	3.60E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	1.82E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	9.50E-06	8.58E-07	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	7.43E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	5.51E-06	4.73E-07	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	1.27E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	3.45E-06	5.19E-06	mr1744	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122694201	NA	3.31E-07	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251