| Variant ID: vg0122459733 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22459733 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAGTTAACCCATAAGAATCCAATTCATAAACAAAAACACCATACTTTTAAATTACACTTAATTTGTTACATATTCTTCTAAACAAACTTAGGTTACCTA[C/T]
GATGAAGATTATAGATAATTGCTTATAGGGATTAATTAAATATTGACGATGTAAAGCTAACTAATATGATAGAAAAAATATCTAAGCAATGTTGACAAAA
TTTTGTCAACATTGCTTAGATATTTTTTCTATCATATTAGTTAGCTTTACATCGTCAATATTTAATTAATCCCTATAAGCAATTATCTATAATCTTCATC[G/A]
TAGGTAACCTAAGTTTGTTTAGAAGAATATGTAACAAATTAAGTGTAATTTAAAAGTATGGTGTTTTTGTTTATGAATTGGATTCTTATGGGTTAACTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.60% | 31.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 81.90% | 18.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 36.80% | 62.90% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 62.80% | 37.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.90% | 96.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 89.90% | 9.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122459733 | C -> T | LOC_Os01g39820.1 | upstream_gene_variant ; 3386.0bp to feature; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| vg0122459733 | C -> T | LOC_Os01g39810.1 | downstream_gene_variant ; 3500.0bp to feature; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| vg0122459733 | C -> T | LOC_Os01g39810.2 | downstream_gene_variant ; 4176.0bp to feature; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| vg0122459733 | C -> T | LOC_Os01g39810.4 | downstream_gene_variant ; 4176.0bp to feature; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| vg0122459733 | C -> T | LOC_Os01g39810.3 | downstream_gene_variant ; 3500.0bp to feature; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| vg0122459733 | C -> T | LOC_Os01g39820-LOC_Os01g39830 | intergenic_region ; MODIFIER | silent_mutation | Average:36.188; most accessible tissue: Callus, score: 61.296 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122459733 | NA | 1.52E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 9.86E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 2.10E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 9.01E-07 | mr1179 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 2.29E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 1.06E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 5.14E-06 | mr1222 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 9.29E-06 | mr1272 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 4.24E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122459733 | NA | 5.31E-07 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/