Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122445996:

Variant ID: vg0122445996 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22445996
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAGAAGATAAATAAGGAGAGAGAAGAGCAGCGGGCTACAGATTTGTAGCGAGCTGTAGCACGGACTCTAAGACGTAGTGTGTATATGACAGGTGGGAC[C/T]
AGATATTAATAGTGTAGTATGTAACTATTGTATGAATGAGCTATTAGATTAGCTATAGATGAATTGAAGCTAGTAGTTGGCTAGAGGCCTTGTTTGGATA

Reverse complement sequence

TATCCAAACAAGGCCTCTAGCCAACTACTAGCTTCAATTCATCTATAGCTAATCTAATAGCTCATTCATACAATAGTTACATACTACACTATTAATATCT[G/A]
GTCCCACCTGTCATATACACACTACGTCTTAGAGTCCGTGCTACAGCTCGCTACAAATCTGTAGCCCGCTGCTCTTCTCTCTCCTTATTTATCTTCTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	10.40%	11.43%	24.90%	NA
All Indica	2759	33.00%	17.20%	15.80%	34.00%	NA
All Japonica	1512	95.10%	0.00%	0.33%	4.56%	NA
Aus	269	35.30%	1.10%	20.82%	42.75%	NA
Indica I	595	13.40%	0.70%	33.28%	52.61%	NA
Indica II	465	19.10%	35.90%	15.70%	29.25%	NA
Indica III	913	50.50%	17.30%	7.34%	24.86%	NA
Indica Intermediate	786	35.60%	18.60%	12.47%	33.33%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	86.90%	0.00%	0.40%	12.70%	NA
Japonica Intermediate	241	97.50%	0.00%	1.24%	1.24%	NA
VI/Aromatic	96	20.80%	2.10%	36.46%	40.62%	NA
Intermediate	90	61.10%	12.20%	8.89%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122445996	C -> T	LOC_Os01g39790.1	upstream_gene_variant ; 3993.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39810.1	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39790.2	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39810.2	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39810.4	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39810.3	upstream_gene_variant ; 4502.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39800.1	downstream_gene_variant ; 275.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39800.2	downstream_gene_variant ; 214.0bp to feature; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> T	LOC_Os01g39790-LOC_Os01g39800	intergenic_region ; MODIFIER	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N
vg0122445996	C -> DEL	N	N	silent_mutation	Average:63.583; most accessible tissue: Callus, score: 97.039	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0122445996	C	T	-0.03	-0.07	-0.03	-0.03	-0.03	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122445996	NA	8.79E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	7.99E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	2.55E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	8.03E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	2.29E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	4.09E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	4.77E-06	mr1185	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	8.06E-08	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	6.52E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	2.45E-06	NA	mr1399	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	8.88E-06	7.23E-09	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	6.87E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	3.75E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	4.30E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	6.26E-06	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122445996	NA	7.42E-06	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251