| Variant ID: vg0122431881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 22431881 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.04, others allele: 0.00, population size: 80. )
AGCGAAACAATTCCAATATACTTGGTGGAACATCATGCAACATTTAAAAATAATTCAATAATAAGCTTAAAAAAAATTTCGTCGGAATATATCCATGCGT[A/G]
GTCTTGTTTTGAAGATTTAATTGCAACAAATTTAATGATGTAATCGGATCATGATTTAGATAAGTAATTTAAGAGAAAAATTAGTTTAAATTGGTTTTGC
GCAAAACCAATTTAAACTAATTTTTCTCTTAAATTACTTATCTAAATCATGATCCGATTACATCATTAAATTTGTTGCAATTAAATCTTCAAAACAAGAC[T/C]
ACGCATGGATATATTCCGACGAAATTTTTTTTAAGCTTATTATTGAATTATTTTTAAATGTTGCATGATGTTCCACCAAGTATATTGGAATTGTTTCGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 6.80% | 1.46% | 36.12% | NA |
| All Indica | 2759 | 29.70% | 11.20% | 2.36% | 56.72% | NA |
| All Japonica | 1512 | 95.30% | 0.10% | 0.07% | 4.56% | NA |
| Aus | 269 | 78.80% | 2.20% | 0.37% | 18.59% | NA |
| Indica I | 595 | 4.00% | 2.00% | 2.02% | 91.93% | NA |
| Indica II | 465 | 11.20% | 2.40% | 4.30% | 82.15% | NA |
| Indica III | 913 | 56.30% | 20.40% | 1.31% | 22.02% | NA |
| Indica Intermediate | 786 | 29.10% | 12.80% | 2.67% | 55.34% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.90% | 0.00% | 0.20% | 12.90% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 70.00% | 4.40% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0122431881 | A -> G | LOC_Os01g39780.1 | upstream_gene_variant ; 4132.0bp to feature; MODIFIER | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| vg0122431881 | A -> G | LOC_Os01g39770.1 | downstream_gene_variant ; 1011.0bp to feature; MODIFIER | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| vg0122431881 | A -> G | LOC_Os01g39770.2 | downstream_gene_variant ; 1011.0bp to feature; MODIFIER | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| vg0122431881 | A -> G | LOC_Os01g39770.3 | downstream_gene_variant ; 1011.0bp to feature; MODIFIER | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| vg0122431881 | A -> G | LOC_Os01g39770-LOC_Os01g39780 | intergenic_region ; MODIFIER | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| vg0122431881 | A -> DEL | N | N | silent_mutation | Average:56.084; most accessible tissue: Minghui63 root, score: 93.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0122431881 | NA | 5.50E-07 | mr1380 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | 1.06E-06 | 9.84E-11 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | 2.60E-06 | 2.60E-06 | mr1875 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | 7.19E-06 | 2.83E-07 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 4.78E-06 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | 8.39E-07 | 8.39E-07 | mr1996 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 4.60E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 5.33E-08 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 4.87E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 1.95E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0122431881 | NA | 5.07E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |