RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0122402967:

Variant ID: vg0122402967 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22402967
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGAGCATCGTCCTTGAAGCCGTGCCTCGGAACCAAGTGACCCATCGTCGTCATCATCATCTTCATCATCGGACAGACATCCACGATGAGCGCGTGATC[G/A]
CCAACAACCTACTACCCCTGGCGGTGGGTGCAGGGCTTTCACTCGTACCCTGCGAGATGTTCGATGGCTTGAGAAGTTCCGACCGGGAGCAATAGAGAAA

Reverse complement sequence

TTTCTCTATTGCTCCCGGTCGGAACTTCTCAAGCCATCGAACATCTCGCAGGGTACGAGTGAAAGCCCTGCACCCACCGCCAGGGGTAGTAGGTTGTTGG[C/T]
GATCACGCGCTCATCGTGGATGTCTGTCCGATGATGAAGATGATGATGACGACGATGGGTCACTTGGTTCCGAGGCACGGCTTCAAGGACGATGCTCGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	34.80%	0.04%	0.00%	NA
All Indica	2759	41.30%	58.60%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	7.70%	92.10%	0.17%	0.00%	NA
Indica II	465	12.30%	87.70%	0.00%	0.00%	NA
Indica III	913	73.90%	26.10%	0.00%	0.00%	NA
Indica Intermediate	786	46.10%	53.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122402967	G -> A	LOC_Os01g39710.1	upstream_gene_variant ; 4929.0bp to feature; MODIFIER	silent_mutation	Average:62.093; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg0122402967	G -> A	LOC_Os01g39730.1	upstream_gene_variant ; 1970.0bp to feature; MODIFIER	silent_mutation	Average:62.093; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg0122402967	G -> A	LOC_Os01g39720.1	intron_variant ; MODIFIER	silent_mutation	Average:62.093; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122402967	NA	2.18E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	1.05E-61	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	5.75E-10	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	1.84E-51	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	3.54E-10	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	2.19E-59	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	1.03E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	4.02E-53	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	2.59E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402967	NA	1.19E-07	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 79 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0122402967:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact