Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122402401:

Variant ID: vg0122402401 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22402401
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCGACGCTGGCCCAACATATCAAAACTCTCAATGCGATATTGAACAAAAGCCCTTTTGATCCCGTCCTGTACGCTGATCTCGATCACTGGGCAGAATG[A/G]
CTACGGGAATCAGTGGCTAATCTCAATAACGCGTTCGCAGAGGCCGCCGCCAGGGCACCACTAGAACAACCGCGGATCGATGGCGCTAATAGGGAACAAC

Reverse complement sequence

GTTGTTCCCTATTAGCGCCATCGATCCGCGGTTGTTCTAGTGGTGCCCTGGCGGCGGCCTCTGCGAACGCGTTATTGAGATTAGCCACTGATTCCCGTAG[T/C]
CATTCTGCCCAGTGATCGAGATCAGCGTACAGGACGGGATCAAAAGGGCTTTTGTTCAATATCGCATTGAGAGTTTTGATATGTTGGGCCAGCGTCGGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.00% 0.00% NA
All Indica  2759 86.60% 13.40% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 74.60% 25.40% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122402401 A -> G LOC_Os01g39710.1 upstream_gene_variant ; 4363.0bp to feature; MODIFIER silent_mutation Average:62.684; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg0122402401 A -> G LOC_Os01g39730.1 upstream_gene_variant ; 2536.0bp to feature; MODIFIER silent_mutation Average:62.684; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N
vg0122402401 A -> G LOC_Os01g39720.1 intron_variant ; MODIFIER silent_mutation Average:62.684; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122402401 NA 1.62E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 8.54E-07 mr1380 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 8.11E-07 5.71E-12 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 6.41E-07 5.51E-11 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 1.59E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 5.77E-08 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 8.88E-07 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 1.44E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 2.11E-06 mr1937 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 3.62E-10 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 4.10E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 1.92E-11 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 5.75E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 2.15E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 1.04E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 3.26E-10 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 9.62E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 6.00E-09 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122402401 NA 3.78E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251