Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0122121060:

Variant ID: vg0122121060 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22121060
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGCACTATCGCCCTAAGTGGCCGTAGAAAATCCAGTTCATGCGATTACCATTGAGTGATTCGTGTTTTACGGTAACGAGTAGTATCACTTGGGGTGG[C/T]
TGGATGCGAGATTGTACAGTGTGCGATCTGTAGTAATAATTAAGTAGAGCACCCGACCAAAGGGAAGCTCGCACCCATCAATTTGCTTCGCCTTAGTAAG

Reverse complement sequence

CTTACTAAGGCGAAGCAAATTGATGGGTGCGAGCTTCCCTTTGGTCGGGTGCTCTACTTAATTATTACTACAGATCGCACACTGTACAATCTCGCATCCA[G/A]
CCACCCCAAGTGATACTACTCGTTACCGTAAAACACGAATCACTCAATGGTAATCGCATGAACTGGATTTTCTACGGCCACTTAGGGCGATAGTGCCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.70% 0.15% 0.00% NA
All Indica  2759 87.20% 12.60% 0.14% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 71.70% 27.90% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 93.30% 6.20% 0.43% 0.00% NA
Indica III  913 78.80% 21.20% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 15.90% 0.25% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 38.90% 58.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122121060 C -> T LOC_Os01g39310.1 intron_variant ; MODIFIER silent_mutation Average:89.441; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N
vg0122121060 C -> T LOC_Os01g39310.3 intron_variant ; MODIFIER silent_mutation Average:89.441; most accessible tissue: Minghui63 flag leaf, score: 94.364 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122121060 C T 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122121060 NA 2.00E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 7.47E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 8.14E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 1.71E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 4.95E-06 8.44E-07 mr1156 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 1.07E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 2.24E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 3.46E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 6.12E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 2.69E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122121060 NA 2.50E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251