Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121726963:

Variant ID: vg0121726963 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21726963
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAAGTCCGATCCCCCGAGCAAAAAAGTTCCGATCTCTTAAAAAGGGGAAAAAGACGGAGAGAAAATAGCGAAAAAAACAACTAACAAAAATAGTCC[G/A]
ATTCAAAAGTGGCAAAAAAAAAACAAAAAATAAAACCGTAGATCGTTTCCCATAAAAAAGGAAAAAAAAGTACGATATCTGTAAAAGGCGGAATAAAAAA

Reverse complement sequence

TTTTTTATTCCGCCTTTTACAGATATCGTACTTTTTTTTCCTTTTTTATGGGAAACGATCTACGGTTTTATTTTTTGTTTTTTTTTTGCCACTTTTGAAT[C/T]
GGACTATTTTTGTTAGTTGTTTTTTTCGCTATTTTCTCTCCGTCTTTTTCCCCTTTTTAAGAGATCGGAACTTTTTTGCTCGGGGGATCGGACTTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.20%	6.20%	11.11%	42.42%	NA
All Indica	2759	6.60%	10.20%	15.40%	67.78%	NA
All Japonica	1512	99.00%	0.10%	0.33%	0.60%	NA
Aus	269	35.70%	3.30%	24.16%	36.80%	NA
Indica I	595	2.90%	12.10%	10.92%	74.12%	NA
Indica II	465	3.70%	17.00%	13.76%	65.59%	NA
Indica III	913	6.60%	4.70%	18.40%	70.32%	NA
Indica Intermediate	786	11.20%	11.20%	16.28%	61.32%	NA
Temperate Japonica	767	99.10%	0.00%	0.26%	0.65%	NA
Tropical Japonica	504	99.20%	0.20%	0.20%	0.40%	NA
Japonica Intermediate	241	98.30%	0.00%	0.83%	0.83%	NA
VI/Aromatic	96	71.90%	0.00%	20.83%	7.29%	NA
Intermediate	90	63.30%	3.30%	11.11%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121726963	G -> A	LOC_Os01g38680.1	upstream_gene_variant ; 1100.0bp to feature; MODIFIER	silent_mutation	Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0121726963	G -> A	LOC_Os01g38690.1	upstream_gene_variant ; 3426.0bp to feature; MODIFIER	silent_mutation	Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0121726963	G -> A	LOC_Os01g38670.1	downstream_gene_variant ; 4822.0bp to feature; MODIFIER	silent_mutation	Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0121726963	G -> A	LOC_Os01g38680-LOC_Os01g38690	intergenic_region ; MODIFIER	silent_mutation	Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0121726963	G -> DEL	N	N	silent_mutation	Average:28.689; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121726963	NA	4.33E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963	6.08E-06	NA	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963	3.29E-06	8.31E-07	mr1380	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963	8.87E-06	NA	mr1561	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121726963	5.30E-06	6.09E-08	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251