RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0121412555:

Variant ID: vg0121412555 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21412555
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGCTGAGAGACACCGCAAAAATGTGTATTTGCTATAAGACATCTTTAAAAACTGGTAATTAGCTGCTGGACACCCGCGGTATTATTTTATTATTTTCA[G/A]
AGGAATAGGAGAGAGAAACCATGTTTAAAAACAAGTTTGCCCTTGGCTCAAATGAATCCAACGTGGGCCCCACATGTGACCTTAAATGTAAGCCCCTCTC

Reverse complement sequence

GAGAGGGGCTTACATTTAAGGTCACATGTGGGGCCCACGTTGGATTCATTTGAGCCAAGGGCAAACTTGTTTTTAAACATGGTTTCTCTCTCCTATTCCT[C/T]
TGAAAATAATAAAATAATACCGCGGGTGTCCAGCAGCTAATTACCAGTTTTTAAAGATGTCTTATAGCAAATACACATTTTTGCGGTGTCTCTCAGCTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	1.10%	1.84%	62.93%	NA
All Indica	2759	4.80%	0.00%	1.05%	94.13%	NA
All Japonica	1512	89.40%	3.20%	3.37%	4.03%	NA
Aus	269	5.60%	0.00%	1.86%	92.57%	NA
Indica I	595	4.00%	0.00%	0.84%	95.13%	NA
Indica II	465	7.30%	0.00%	1.08%	91.61%	NA
Indica III	913	2.20%	0.00%	0.66%	97.15%	NA
Indica Intermediate	786	7.00%	0.00%	1.65%	91.35%	NA
Temperate Japonica	767	84.40%	6.00%	5.74%	3.91%	NA
Tropical Japonica	504	97.00%	0.00%	0.60%	2.38%	NA
Japonica Intermediate	241	89.60%	0.80%	1.66%	7.88%	NA
VI/Aromatic	96	68.80%	0.00%	1.04%	30.21%	NA
Intermediate	90	50.00%	6.70%	1.11%	42.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121412555	G -> A	LOC_Os01g38229.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0121412555	G -> A	LOC_Os01g38229.4	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0121412555	G -> A	LOC_Os01g38229.3	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0121412555	G -> A	LOC_Os01g38229.2	upstream_gene_variant ; 2514.0bp to feature; MODIFIER	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0121412555	G -> A	LOC_Os01g38200-LOC_Os01g38229	intergenic_region ; MODIFIER	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0121412555	G -> DEL	N	N	silent_mutation	Average:13.309; most accessible tissue: Callus, score: 86.581	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121412555	3.03E-06	NA	mr1124	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555	1.05E-06	2.28E-06	mr1134	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555	1.55E-06	NA	mr1149	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121412555	2.15E-06	NA	mr1202	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0121412555:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact