Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0121389895:

Variant ID: vg0121389895 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 21389895
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

CGTCAAGAACATAAGAAAACGTTGTTTTGGGTTGGAGAGATGTTCAGCAAACCCGGTTGAAAGAGATGCTAAGTAGAGGAAGAGGTAGAAATTAGGCAAA[A/T]
TTGGTTATATAGCATTGAAAGTTCACGCTTTTAGGCCCCCTTTGAATCGCAGGGTAGAAAAAACGGAGGAATAGGAAAAACACATGATTCTGACAGGAAT

Reverse complement sequence

ATTCCTGTCAGAATCATGTGTTTTTCCTATTCCTCCGTTTTTTCTACCCTGCGATTCAAAGGGGGCCTAAAAGCGTGAACTTTCAATGCTATATAACCAA[T/A]
TTTGCCTAATTTCTACCTCTTCCTCTACTTAGCATCTCTTTCAACCGGGTTTGCTGAACATCTCTCCAACCCAAAACAACGTTTTCTTATGTTCTTGACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	39.90%	5.50%	8.42%	NA
All Indica	2759	72.20%	6.10%	9.03%	12.72%	NA
All Japonica	1512	0.90%	98.70%	0.20%	0.13%	NA
Aus	269	47.60%	36.10%	1.49%	14.87%	NA
Indica I	595	80.80%	1.20%	13.28%	4.71%	NA
Indica II	465	65.40%	8.00%	11.83%	14.84%	NA
Indica III	913	78.00%	3.20%	4.38%	14.46%	NA
Indica Intermediate	786	62.80%	12.10%	9.54%	15.52%	NA
Temperate Japonica	767	0.90%	98.80%	0.26%	0.00%	NA
Tropical Japonica	504	0.40%	99.20%	0.00%	0.40%	NA
Japonica Intermediate	241	2.10%	97.50%	0.41%	0.00%	NA
VI/Aromatic	96	28.10%	67.70%	1.04%	3.12%	NA
Intermediate	90	26.70%	67.80%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0121389895	A -> T	LOC_Os01g38180.1	downstream_gene_variant ; 251.0bp to feature; MODIFIER	silent_mutation	Average:30.098; most accessible tissue: Zhenshan97 flower, score: 39.624	N	N	N	N
vg0121389895	A -> T	LOC_Os01g38190.1	downstream_gene_variant ; 2334.0bp to feature; MODIFIER	silent_mutation	Average:30.098; most accessible tissue: Zhenshan97 flower, score: 39.624	N	N	N	N
vg0121389895	A -> T	LOC_Os01g38180-LOC_Os01g38190	intergenic_region ; MODIFIER	silent_mutation	Average:30.098; most accessible tissue: Zhenshan97 flower, score: 39.624	N	N	N	N
vg0121389895	A -> DEL	N	N	silent_mutation	Average:30.098; most accessible tissue: Zhenshan97 flower, score: 39.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0121389895	7.90E-06	7.90E-06	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121389895	NA	1.09E-20	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121389895	NA	1.33E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121389895	NA	3.10E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121389895	NA	5.10E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0121389895	NA	9.70E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251