Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120603377:

Variant ID: vg0120603377 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 20603377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTTTTACTGTGTTTAGATCCAAAGTTTGGATGCAAACTTCAGTCATTTTCCATCACATCAACATGTCATACACACAACTTTTCAGTCACATCATCTT[C/T]
AATTTTAACCAAAATCCAAACTTTGCGTTGAACTAAACATAGCCTTGAATTATGAAAAGTTGTAGCCGTATAATCCAGAAAATAAATTAGAAACCAAAAA

Reverse complement sequence

TTTTTGGTTTCTAATTTATTTTCTGGATTATACGGCTACAACTTTTCATAATTCAAGGCTATGTTTAGTTCAACGCAAAGTTTGGATTTTGGTTAAAATT[G/A]
AAGATGATGTGACTGAAAAGTTGTGTGTATGACATGTTGATGTGATGGAAAATGACTGAAGTTTGCATCCAAACTTTGGATCTAAACACAGTAAAAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 9.60% 0.97% 0.00% NA
All Indica  2759 91.00% 8.60% 0.40% 0.00% NA
All Japonica  1512 95.20% 2.60% 2.25% 0.00% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 80.40% 19.60% 0.00% 0.00% NA
Indica III  913 96.70% 3.20% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 14.80% 1.15% 0.00% NA
Temperate Japonica  767 94.00% 2.00% 4.04% 0.00% NA
Tropical Japonica  504 98.20% 1.60% 0.20% 0.00% NA
Japonica Intermediate  241 92.50% 6.60% 0.83% 0.00% NA
VI/Aromatic  96 55.20% 43.80% 1.04% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0120603377 C -> T LOC_Os01g36950.1 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N
vg0120603377 C -> T LOC_Os01g36950.2 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N
vg0120603377 C -> T LOC_Os01g36950.4 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N
vg0120603377 C -> T LOC_Os01g36950.3 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N
vg0120603377 C -> T LOC_Os01g36940.1 downstream_gene_variant ; 4525.0bp to feature; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N
vg0120603377 C -> T LOC_Os01g36950-LOC_Os01g36960 intergenic_region ; MODIFIER silent_mutation Average:89.612; most accessible tissue: Minghui63 flag leaf, score: 99.344 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0120603377 C T 0.02 0.01 0.02 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0120603377 NA 1.92E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 8.79E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 3.02E-06 mr1047 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 1.39E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 2.26E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 7.50E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 4.48E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 4.98E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 4.09E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 1.36E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 3.24E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 7.98E-08 mr1684 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 7.72E-06 mr1684 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 2.31E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 3.80E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 2.65E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 3.66E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 6.95E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120603377 NA 7.83E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251