Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120297000:

Variant ID: vg0120297000 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 20297000
Reference Allele: GA	Alternative Allele: AA,G
Primary Allele: GA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCATTTCCTTTTTCCCCCTTTTAATTGTCTGTATAACTGTATTAATTGACTTTACTCCCTTGATTTAATTAAAAAAATAGCAGACCTTCTGTTGTTCCT[GA/AA,G]
AAAAAAATTGTTGGTAATGTGCATCGCTTTAGTGTTGGATAGCCCAGTATGTCAACATGAAGGAGAGAGGTTTAAGAAGGGGACAGTACAATGCATGCAA

Reverse complement sequence

TTGCATGCATTGTACTGTCCCCTTCTTAAACCTCTCTCCTTCATGTTGACATACTGGGCTATCCAACACTAAAGCGATGCACATTACCAACAATTTTTTT[TC/TT,C]
AGGAACAACAGAAGGTCTGCTATTTTTTTAATTAAATCAAGGGAGTAAAGTCAATTAATACAGTTATACAGACAATTAAAAGGGGGAAAAAGGAAATGCA

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	0.70%	1.71%	0.00%	G: 0.13%
All Indica	2759	99.50%	0.00%	0.54%	0.00%	NA
All Japonica	1512	93.80%	1.90%	3.97%	0.00%	G: 0.40%
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.40%	0.00%	0.65%	0.00%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	98.90%	0.00%	1.15%	0.00%	NA
Temperate Japonica	767	90.50%	3.10%	6.39%	0.00%	NA
Tropical Japonica	504	98.60%	0.20%	0.99%	0.00%	G: 0.20%
Japonica Intermediate	241	94.20%	1.20%	2.49%	0.00%	G: 2.07%
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	1.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120297000	GA -> G	LOC_Os01g36570.1	downstream_gene_variant ; 4115.0bp to feature; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0120297000	GA -> G	LOC_Os01g36580.1	downstream_gene_variant ; 2521.0bp to feature; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0120297000	GA -> G	LOC_Os01g36570-LOC_Os01g36580	intergenic_region ; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0120297000	GA -> AA	LOC_Os01g36570.1	downstream_gene_variant ; 4114.0bp to feature; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0120297000	GA -> AA	LOC_Os01g36580.1	downstream_gene_variant ; 2522.0bp to feature; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0120297000	GA -> AA	LOC_Os01g36570-LOC_Os01g36580	intergenic_region ; MODIFIER	silent_mutation	Average:51.079; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120297000	5.02E-08	3.03E-09	mr1038_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120297000	1.35E-11	1.35E-11	mr1389_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120297000	NA	9.22E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120297000	NA	4.71E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120297000	NA	6.35E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120297000	NA	3.15E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251