Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0120108656:

Variant ID: vg0120108656 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 20108656
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCACATCTTTCGTCGGTCGGACGAATTCCACAATAGTCCCGGTTACAATAAAAACCGGGACTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAATA[G/A]
GCATATTTAATCTTTAGTCCCGGTTGGTATCATCTTTAGTCCCGGTTCAAATGCTGTCAGGGCTTGTCAGGCCCTCATTAGCCCCGGTTTGTAACACCAA

Reverse complement sequence

TTGGTGTTACAAACCGGGGCTAATGAGGGCCTGACAAGCCCTGACAGCATTTGAACCGGGACTAAAGATGATACCAACCGGGACTAAAGATTAAATATGC[C/T]
TATTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGTCCCGGTTTTTATTGTAACCGGGACTATTGTGGAATTCGTCCGACCGACGAAAGATGTGAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.60%	4.00%	4.44%	14.96%	NA
All Indica	2759	61.00%	6.80%	6.92%	25.23%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	92.90%	0.00%	5.95%	1.12%	NA
Indica I	595	29.70%	0.50%	9.92%	59.83%	NA
Indica II	465	64.90%	0.00%	6.88%	28.17%	NA
Indica III	913	78.60%	13.90%	2.96%	4.49%	NA
Indica Intermediate	786	62.00%	7.40%	9.29%	21.37%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	1.10%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0120108656	G -> A	LOC_Os01g36280.1	upstream_gene_variant ; 985.0bp to feature; MODIFIER	silent_mutation	Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0120108656	G -> A	LOC_Os01g36270-LOC_Os01g36280	intergenic_region ; MODIFIER	silent_mutation	Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0120108656	G -> DEL	N	N	silent_mutation	Average:46.944; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0120108656	NA	1.51E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656	NA	1.09E-07	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656	NA	6.27E-07	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656	NA	9.68E-07	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656	NA	7.65E-11	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0120108656	NA	7.02E-10	mr1980_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251