Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0119206650:

Variant ID: vg0119206650 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 19206650
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCACCATTGGGTAGCTATAGGTCCGTGTATGTGTATTAGCTAGCTGCCTAGCGCTTACTACTCTGTCTAAAAAACGAATTCCTACCTACGAACTTGGAC[A/G]
CACATGTGTCCAGATTCGTAGTCGTAGGTAGGATTGGTCTTTTTTTTTTTACGGAGGGGTACGTGTTCAACTGAATAAGAATGTGTACATCATGCATGCA

Reverse complement sequence

TGCATGCATGATGTACACATTCTTATTCAGTTGAACACGTACCCCTCCGTAAAAAAAAAAAGACCAATCCTACCTACGACTACGAATCTGGACACATGTG[T/C]
GTCCAAGTTCGTAGGTAGGAATTCGTTTTTTAGACAGAGTAGTAAGCGCTAGGCAGCTAGCTAATACACATACACGGACCTATAGCTACCCAATGGTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.30% 0.28% 0.30% NA
All Indica  2759 93.00% 6.10% 0.36% 0.51% NA
All Japonica  1512 82.00% 18.00% 0.00% 0.00% NA
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 86.50% 12.00% 0.33% 1.10% NA
Indica Intermediate  786 92.70% 6.10% 0.76% 0.38% NA
Temperate Japonica  767 73.30% 26.70% 0.00% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0119206650 A -> G LOC_Os01g34800.1 upstream_gene_variant ; 4891.0bp to feature; MODIFIER silent_mutation Average:75.356; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0119206650 A -> G LOC_Os01g34790-LOC_Os01g34800 intergenic_region ; MODIFIER silent_mutation Average:75.356; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0119206650 A -> DEL N N silent_mutation Average:75.356; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0119206650 A G 0.01 -0.03 -0.02 -0.05 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0119206650 3.60E-06 NA mr1648 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119206650 NA 5.16E-08 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119206650 NA 3.57E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0119206650 NA 9.09E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251