| Variant ID: vg0118434108 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18434108 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGAGGAGTAACATTTTTCTTTAAGCAAATGTGAAGGTTGTTATGTCCTCAATGAGTTAGCGTAATGCGTATCCCGCCAAATACGTTGATGTGATGTGAT[G/A]
CGGCAAATGAGCAAATGGTATTTTGTACCTTTTCTTTTTTTTTAGTCAATAGGAATGCCGCACTATTAAGAGGGATGATGCATTGACATATGAGGAGTGA
TCACTCCTCATATGTCAATGCATCATCCCTCTTAATAGTGCGGCATTCCTATTGACTAAAAAAAAAGAAAAGGTACAAAATACCATTTGCTCATTTGCCG[C/T]
ATCACATCACATCAACGTATTTGGCGGGATACGCATTACGCTAACTCATTGAGGACATAACAACCTTCACATTTGCTTAAAGAAAAATGTTACTCCTCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 0.90% | 3.70% | 7.62% | NA |
| All Indica | 2759 | 79.80% | 1.50% | 6.09% | 12.65% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Aus | 269 | 96.30% | 0.00% | 1.49% | 2.23% | NA |
| Indica I | 595 | 78.00% | 0.00% | 10.08% | 11.93% | NA |
| Indica II | 465 | 87.70% | 6.70% | 3.66% | 1.94% | NA |
| Indica III | 913 | 73.20% | 0.20% | 3.94% | 22.67% | NA |
| Indica Intermediate | 786 | 84.10% | 1.00% | 7.00% | 7.89% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118434108 | G -> A | LOC_Os01g33480.1 | upstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118434108 | G -> A | LOC_Os01g33460.1 | downstream_gene_variant ; 3341.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118434108 | G -> A | LOC_Os01g33470.1 | downstream_gene_variant ; 652.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118434108 | G -> A | LOC_Os01g33490.1 | downstream_gene_variant ; 4200.0bp to feature; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118434108 | G -> A | LOC_Os01g33470-LOC_Os01g33480 | intergenic_region ; MODIFIER | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg0118434108 | G -> DEL | N | N | silent_mutation | Average:20.985; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118434108 | 2.01E-06 | 1.77E-07 | mr1268 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118434108 | NA | 4.93E-06 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118434108 | NA | 3.75E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |