Variant ID: vg0118347734 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 18347734 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 281. )
TAATACTAGATGATACCCCGCGCGATGCTGCGGAATACTATGTGAAAAAAGTAGTATGATTGAAGGAAAGATATAAAAATAAAGCCAATCTACCAAAGGA[A/G]
TTCTATAGTTTGATTGGTATATAATATGTCTGCCATATAAGCAATCTAACAGGGTCATGTATAAGTTCAAATGACGGTTATGTTGTTCAGAGAGTATATA
TATATACTCTCTGAACAACATAACCGTCATTTGAACTTATACATGACCCTGTTAGATTGCTTATATGGCAGACATATTATATACCAATCAAACTATAGAA[T/C]
TCCTTTGGTAGATTGGCTTTATTTTTATATCTTTCCTTCAATCATACTACTTTTTTCACATAGTATTCCGCAGCATCGCGCGGGGTATCATCTAGTATTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0118347734 | A -> G | LOC_Os01g33290.1 | downstream_gene_variant ; 2108.0bp to feature; MODIFIER | silent_mutation | Average:48.004; most accessible tissue: Callus, score: 83.149 | N | N | N | N |
vg0118347734 | A -> G | LOC_Os01g33270-LOC_Os01g33290 | intergenic_region ; MODIFIER | silent_mutation | Average:48.004; most accessible tissue: Callus, score: 83.149 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0118347734 | 4.10E-09 | 4.10E-09 | mr1008 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0118347734 | 1.00E-09 | 1.00E-09 | mr1009 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0118347734 | 1.32E-07 | 1.32E-07 | mr1014 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0118347734 | 5.66E-06 | NA | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |