Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118253541:

Variant ID: vg0118253541 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18253541
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGATATCCTAATTAATAGATAGAATTGCCTTCCCAGAACTCTATCCGTGCGTGGCAATCATCTTGAAATACATTAACTTGAACCCGATGTCGCGTAC[A/G]
AGTTGTATTGTCGGAATCGGCTATATCGGCTTATTTAGCCCGACTCAGATCCAGCCGATCCTAACCATAGCCGATCTGGATTCCAGACGATTCCTGCTCT

Reverse complement sequence

AGAGCAGGAATCGTCTGGAATCCAGATCGGCTATGGTTAGGATCGGCTGGATCTGAGTCGGGCTAAATAAGCCGATATAGCCGATTCCGACAATACAACT[T/C]
GTACGCGACATCGGGTTCAAGTTAATGTATTTCAAGATGATTGCCACGCACGGATAGAGTTCTGGGAAGGCAATTCTATCTATTAATTAGGATATCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	23.00%	0.23%	0.00%	NA
All Indica	2759	61.00%	38.60%	0.40%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	90.80%	9.10%	0.17%	0.00%	NA
Indica II	465	50.50%	49.20%	0.22%	0.00%	NA
Indica III	913	47.20%	52.50%	0.33%	0.00%	NA
Indica Intermediate	786	60.60%	38.70%	0.76%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118253541	A -> G	LOC_Os01g33142.1	upstream_gene_variant ; 3432.0bp to feature; MODIFIER	silent_mutation	Average:39.672; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0118253541	A -> G	LOC_Os01g33150.1	upstream_gene_variant ; 444.0bp to feature; MODIFIER	silent_mutation	Average:39.672; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0118253541	A -> G	LOC_Os01g33142-LOC_Os01g33150	intergenic_region ; MODIFIER	silent_mutation	Average:39.672; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118253541	NA	4.87E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	2.66E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	1.95E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	1.77E-06	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	3.77E-06	3.77E-06	mr1562	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	1.28E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	2.42E-06	2.42E-06	mr1762	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	2.91E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	4.18E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118253541	NA	8.02E-07	mr1762_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251