Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118219645:

Variant ID: vg0118219645 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18219645
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGCTGAGGCAGAGGTGGCAGAACGAAGAGGATATGGACGGGGCGGCGGCGAGTCTCTATGGCAGCCATCGTGTTCCTCAGTCCTCCCATGGCTAGCA[T/C]
GGCTCCGACCCCTCTCTTTGCGACGCCGGTCAAGCTTTGTGCCGCCGACGTATAGCTCCTCCCTCGCCGGTCGAGCCCGTCGCACCGTGGAGAGGAGAGG

Reverse complement sequence

CCTCTCCTCTCCACGGTGCGACGGGCTCGACCGGCGAGGGAGGAGCTATACGTCGGCGGCACAAAGCTTGACCGGCGTCGCAAAGAGAGGGGTCGGAGCC[A/G]
TGCTAGCCATGGGAGGACTGAGGAACACGATGGCTGCCATAGAGACTCGCCGCCGCCCCGTCCATATCCTCTTCGTTCTGCCACCTCTGCCTCAGCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	14.10%	0.42%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.04%	0.00%	NA
All Japonica	1512	65.90%	33.00%	1.06%	0.00%	NA
Aus	269	77.30%	22.30%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.00%	0.13%	0.00%	NA
Temperate Japonica	767	93.00%	6.30%	0.78%	0.00%	NA
Tropical Japonica	504	25.80%	72.80%	1.39%	0.00%	NA
Japonica Intermediate	241	63.90%	34.90%	1.24%	0.00%	NA
VI/Aromatic	96	33.30%	65.60%	1.04%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118219645	T -> C	LOC_Os01g33100.1	upstream_gene_variant ; 4562.0bp to feature; MODIFIER	silent_mutation	Average:85.046; most accessible tissue: Zhenshan97 young leaf, score: 94.111	N	N	N	N
vg0118219645	T -> C	LOC_Os01g33100-LOC_Os01g33110	intergenic_region ; MODIFIER	silent_mutation	Average:85.046; most accessible tissue: Zhenshan97 young leaf, score: 94.111	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0118219645	T	C	0.01	0.01	0.01	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118219645	NA	7.21E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.21E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.88E-13	mr1398_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	2.51E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	6.85E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	5.84E-16	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	6.49E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.09E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	5.31E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.47E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	2.52E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.47E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118219645	NA	1.90E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251