| Variant ID: vg0118080333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 18080333 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACCGCCGGCCGCCACGCCGCCGCCGGATCTGTGGCCTCCACCACCGCCGCTCCATCGCCATCGCCATTCCCGCCGGCCATCACCCACAACTCCACCCAG[C/T]
GCAACTCACCTCGACCGCCTCCATCACCCGTCCCCACCGCCACCGTCCTTGCGGCCGCGCGGCTTTGCCGGCGGTGTGGAGATTGTGGGTACCCAATACC
GGTATTGGGTACCCACAATCTCCACACCGCCGGCAAAGCCGCGCGGCCGCAAGGACGGTGGCGGTGGGGACGGGTGATGGAGGCGGTCGAGGTGAGTTGC[G/A]
CTGGGTGGAGTTGTGGGTGATGGCCGGCGGGAATGGCGATGGCGATGGAGCGGCGGTGGTGGAGGCCACAGATCCGGCGGCGGCGTGGCGGCCGGCGGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.40% | 2.30% | 0.51% | 0.70% | NA |
| All Indica | 2759 | 98.00% | 0.10% | 0.69% | 1.20% | NA |
| All Japonica | 1512 | 92.90% | 7.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 92.70% | 0.00% | 1.94% | 5.38% | NA |
| Indica III | 913 | 99.60% | 0.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 0.10% | 0.64% | 0.89% | NA |
| Temperate Japonica | 767 | 95.70% | 4.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0118080333 | C -> T | LOC_Os01g32940.1 | upstream_gene_variant ; 33.0bp to feature; MODIFIER | silent_mutation | Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0118080333 | C -> T | LOC_Os01g32930.1 | downstream_gene_variant ; 2148.0bp to feature; MODIFIER | silent_mutation | Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0118080333 | C -> T | LOC_Os01g32950.1 | downstream_gene_variant ; 690.0bp to feature; MODIFIER | silent_mutation | Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0118080333 | C -> T | LOC_Os01g32940-LOC_Os01g32950 | intergenic_region ; MODIFIER | silent_mutation | Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0118080333 | C -> DEL | N | N | silent_mutation | Average:69.936; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0118080333 | 1.39E-08 | 1.39E-08 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118080333 | 1.22E-08 | 1.22E-08 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118080333 | 2.95E-07 | 2.95E-07 | mr1200 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0118080333 | NA | 4.24E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/