Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0118034244:

Variant ID: vg0118034244 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 18034244
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAGTAAAATAAGCAAGGATAAGTAAATCTAGCATCATTTTAATTTATGGACAGCAAGTATATAATTCTGAAATGTATAAGCAAATGAGCCCAAACGGC[G/A]
CTCTCATCATCATCCATGGACTACCAAAGTCCATACCAACATGGCACAACATGCCAACACCACCATCAAGCATAATCACATCCATAATAATCCACATTTG

Reverse complement sequence

CAAATGTGGATTATTATGGATGTGATTATGCTTGATGGTGGTGTTGGCATGTTGTGCCATGTTGGTATGGACTTTGGTAGTCCATGGATGATGATGAGAG[C/T]
GCCGTTTGGGCTCATTTGCTTATACATTTCAGAATTATATACTTGCTGTCCATAAATTAAAATGATGCTAGATTTACTTATCCTTGCTTATTTTACTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	0.90%	2.98%	4.04%	NA
All Indica	2759	91.00%	1.20%	3.99%	3.81%	NA
All Japonica	1512	99.30%	0.00%	0.13%	0.53%	NA
Aus	269	58.40%	3.00%	10.41%	28.25%	NA
Indica I	595	93.10%	0.20%	3.36%	3.36%	NA
Indica II	465	98.50%	0.00%	1.29%	0.22%	NA
Indica III	913	85.80%	2.80%	5.70%	5.70%	NA
Indica Intermediate	786	91.10%	0.80%	4.07%	4.07%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	98.20%	0.00%	0.20%	1.59%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	2.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0118034244	G -> A	LOC_Os01g32849.1	upstream_gene_variant ; 3855.0bp to feature; MODIFIER	silent_mutation	Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0118034244	G -> A	LOC_Os01g32860.1	upstream_gene_variant ; 1627.0bp to feature; MODIFIER	silent_mutation	Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0118034244	G -> A	LOC_Os01g32864.1	intron_variant ; MODIFIER	silent_mutation	Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0118034244	G -> DEL	N	N	silent_mutation	Average:42.774; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0118034244	6.73E-06	NA	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0118034244	1.27E-07	5.64E-07	mr1745	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251