Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0117419683:

Variant ID: vg0117419683 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 17419683
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTGTAAAACCGCGCTCCGTAAGGACGGCAAGGGGGCCGCCTGCAAAATGGCAGGCCCCCTATAACCGGCCGTAAGGACTTAGCTAACGGCCGTGTGCCA[C/T]
GCCACAAAAATCGCCCTCTCCAAGGGCGGCGGGCGACTAGTTTTGTAAAATTTTCAAACACAAAATTAGTTTTATAAATATTTTAATAAAAAAATTCAAA

Reverse complement sequence

TTTGAATTTTTTTATTAAAATATTTATAAAACTAATTTTGTGTTTGAAAATTTTACAAAACTAGTCGCCCGCCGCCCTTGGAGAGGGCGATTTTTGTGGC[G/A]
TGGCACACGGCCGTTAGCTAAGTCCTTACGGCCGGTTATAGGGGGCCTGCCATTTTGCAGGCGGCCCCCTTGCCGTCCTTACGGAGCGCGGTTTTACACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.10%	0.20%	0.68%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.04%	0.00%	NA
All Japonica	1512	97.30%	0.70%	2.05%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	95.40%	1.20%	3.39%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	0.40%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0117419683	C -> T	LOC_Os01g31790.1	upstream_gene_variant ; 999.0bp to feature; MODIFIER	silent_mutation	Average:71.135; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0117419683	C -> T	LOC_Os01g31800.1	upstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:71.135; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0117419683	C -> T	LOC_Os01g31810.2	downstream_gene_variant ; 3117.0bp to feature; MODIFIER	silent_mutation	Average:71.135; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0117419683	C -> T	LOC_Os01g31790-LOC_Os01g31800	intergenic_region ; MODIFIER	silent_mutation	Average:71.135; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0117419683	NA	1.53E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	2.46E-08	9.63E-11	mr1038_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	NA	7.17E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	NA	4.05E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	9.40E-11	9.40E-11	mr1389_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	NA	7.12E-09	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	9.79E-07	1.26E-10	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	NA	2.76E-08	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0117419683	NA	2.22E-08	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251