Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116188975:

Variant ID: vg0116188975 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 16188975
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CCTAGACACCTTAGGAAACCCTCTAGTACAAGAAAGAAACTTTACATAACCAATCGTACTAAATTTGGACTCCTTCCAAATTCGACTCCGCATCCCATAC[A/G]
CACACAATACCTCCATCGTTTGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCATGATATCTGACCACCACGGACATC

Reverse complement sequence

GATGTCCGTGGTGGTCAGATATCATGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCAAACGATGGAGGTATTGTGTG[T/C]
GTATGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATTTAGTACGATTGGTTATGTAAAGTTTCTTTCTTGTACTAGAGGGTTTCCTAAGGTGTCTAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.80%	37.20%	0.04%	0.00%	NA
All Indica	2759	97.10%	2.90%	0.04%	0.00%	NA
All Japonica	1512	4.10%	95.90%	0.00%	0.00%	NA
Aus	269	67.70%	32.00%	0.37%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	98.80%	1.10%	0.11%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	10.40%	89.60%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0116188975	A -> G	LOC_Os01g28894.1	downstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:33.048; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N
vg0116188975	A -> G	LOC_Os01g28882.1	intron_variant ; MODIFIER	silent_mutation	Average:33.048; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0116188975	NA	5.18E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	9.23E-26	mr1731	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.63E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	3.79E-44	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	4.63E-07	2.54E-10	mr1568_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	6.49E-19	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	3.43E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.52E-19	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	8.72E-15	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	4.47E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.02E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	9.71E-11	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	4.12E-16	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	4.08E-17	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.46E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.31E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.72E-11	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	8.94E-06	3.22E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	NA	1.72E-11	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116188975	8.94E-06	3.22E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251