Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115090442:

Variant ID: vg0115090442 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 15090442
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGTGGGCCGAGTGCCCTAGGCCCATGCGGACTGCTTGGTGATTAAGAAAGGGATTAAAAGACAAGGCTATAGATCTTATCGTGTAGGCACGCGGACAC[C/T]
GCACGATGCACCTCCCCGAATCGTGGCTGCTGCACACTACTGAACTTGTGCAACGCCATTCGTCCAACTCATTGATCCCACGGAGCATGTTGCACCACGC

Reverse complement sequence

GCGTGGTGCAACATGCTCCGTGGGATCAATGAGTTGGACGAATGGCGTTGCACAAGTTCAGTAGTGTGCAGCAGCCACGATTCGGGGAGGTGCATCGTGC[G/A]
GTGTCCGCGTGCCTACACGATAAGATCTATAGCCTTGTCTTTTAATCCCTTTCTTAATCACCAAGCAGTCCGCATGGGCCTAGGGCACTCGGCCCACCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 3.70% 0.55% 15.79% NA
All Indica  2759 76.30% 0.00% 0.76% 22.91% NA
All Japonica  1512 86.50% 11.20% 0.13% 2.12% NA
Aus  269 69.90% 0.00% 0.74% 29.37% NA
Indica I  595 61.80% 0.00% 1.34% 36.81% NA
Indica II  465 96.10% 0.00% 0.43% 3.44% NA
Indica III  913 73.50% 0.10% 0.66% 25.74% NA
Indica Intermediate  786 78.80% 0.00% 0.64% 20.61% NA
Temperate Japonica  767 94.70% 4.40% 0.00% 0.91% NA
Tropical Japonica  504 89.50% 5.80% 0.40% 4.37% NA
Japonica Intermediate  241 54.40% 44.40% 0.00% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 3.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0115090442 C -> T LOC_Os01g27060.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:57.424; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0115090442 C -> T LOC_Os01g27050.1 downstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:57.424; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0115090442 C -> T LOC_Os01g27050-LOC_Os01g27060 intergenic_region ; MODIFIER silent_mutation Average:57.424; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0115090442 C -> DEL N N silent_mutation Average:57.424; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0115090442 C T 0.19 0.1 0.06 0.28 0.2 0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0115090442 NA 4.99E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 4.41E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 3.10E-06 3.10E-06 mr1651 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 1.94E-06 3.78E-08 mr1719 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 3.27E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 3.95E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 1.52E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 1.08E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115090442 NA 1.13E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251