Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0115022018:

Variant ID: vg0115022018 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 15022018
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCCGTTCAAACCGTTGCTGTCAGCTCCTTAAAATGTTGGTCCCCCAAGTTAATTTTTTTAATGAAACGGCAGGAGGATTGGCATTTGATTAAATTAGC[A/G]
AGGAAGTAAAGATTCCAAAATTTCAAAGAAAATGCCAAGGGGCCAAGAAGACAGTTTACAGTTGTTGCCTTTCTAGTAATTATCTAGTCTCTAAACATGA

Reverse complement sequence

TCATGTTTAGAGACTAGATAATTACTAGAAAGGCAACAACTGTAAACTGTCTTCTTGGCCCCTTGGCATTTTCTTTGAAATTTTGGAATCTTTACTTCCT[T/C]
GCTAATTTAATCAAATGCCAATCCTCCTGCCGTTTCATTAAAAAAATTAACTTGGGGGACCAACATTTTAAGGAGCTGACAGCAACGGTTTGAACGGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.40%	3.10%	0.38%	62.06%	NA
All Indica	2759	5.30%	3.00%	0.47%	91.23%	NA
All Japonica	1512	86.20%	0.10%	0.00%	13.69%	NA
Aus	269	33.50%	1.90%	1.86%	62.83%	NA
Indica I	595	3.00%	0.00%	0.17%	96.81%	NA
Indica II	465	7.50%	12.00%	1.29%	79.14%	NA
Indica III	913	3.10%	0.70%	0.22%	96.06%	NA
Indica Intermediate	786	8.30%	2.70%	0.51%	88.55%	NA
Temperate Japonica	767	94.70%	0.00%	0.00%	5.35%	NA
Tropical Japonica	504	89.10%	0.00%	0.00%	10.91%	NA
Japonica Intermediate	241	53.10%	0.80%	0.00%	46.06%	NA
VI/Aromatic	96	39.60%	56.20%	0.00%	4.17%	NA
Intermediate	90	56.70%	3.30%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0115022018	A -> G	LOC_Os01g26960.1	upstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26980.1	upstream_gene_variant ; 3820.0bp to feature; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26970.5	intron_variant ; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26970.3	intron_variant ; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26970.1	intron_variant ; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26970.2	intron_variant ; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> G	LOC_Os01g26970.4	intron_variant ; MODIFIER	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N
vg0115022018	A -> DEL	N	N	silent_mutation	Average:7.24; most accessible tissue: Callus, score: 21.988	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0115022018	NA	4.87E-08	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	6.95E-54	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	2.91E-07	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	3.87E-06	mr1719	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	4.21E-06	6.74E-09	mr1064_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	5.06E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	3.70E-08	5.15E-59	mr1519_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	1.81E-07	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0115022018	NA	1.37E-08	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251