| Variant ID: vg0114563116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14563116 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, G: 0.15, others allele: 0.00, population size: 73. )
GAGTTTGGGTGGCCATAACCCCAGCCAGAGTGGTTAGGTCAGGTGTCTGAGTTTCGTCGTTGCTGGTTGTTGCCCGACGACGGCTTGCCATCTGTGTAGG[T/G]
TGATGGGGTAAGTATCCTAATTTTCTAACTAGCTCCTATGGCTTTATCCTATTAAGGGAGTTGTGTTGATATGAACTTTGTTTTGCAAGCATGGTGGAAT
ATTCCACCATGCTTGCAAAACAAAGTTCATATCAACACAACTCCCTTAATAGGATAAAGCCATAGGAGCTAGTTAGAAAATTAGGATACTTACCCCATCA[A/C]
CCTACACAGATGGCAAGCCGTCGTCGGGCAACAACCAGCAACGACGAAACTCAGACACCTGACCTAACCACTCTGGCTGGGGTTATGGCCACCCAAACTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 8.80% | 5.78% | 54.06% | NA |
| All Indica | 2759 | 15.10% | 7.60% | 8.77% | 68.54% | NA |
| All Japonica | 1512 | 55.30% | 10.60% | 0.66% | 33.40% | NA |
| Aus | 269 | 36.40% | 10.80% | 5.58% | 47.21% | NA |
| Indica I | 595 | 6.20% | 2.70% | 4.20% | 86.89% | NA |
| Indica II | 465 | 21.70% | 9.20% | 11.61% | 57.42% | NA |
| Indica III | 913 | 16.20% | 9.30% | 10.08% | 64.40% | NA |
| Indica Intermediate | 786 | 16.50% | 8.40% | 9.03% | 66.03% | NA |
| Temperate Japonica | 767 | 86.00% | 0.10% | 0.52% | 13.30% | NA |
| Tropical Japonica | 504 | 12.70% | 29.80% | 0.79% | 56.75% | NA |
| Japonica Intermediate | 241 | 46.50% | 4.10% | 0.83% | 48.55% | NA |
| VI/Aromatic | 96 | 91.70% | 5.20% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 50.00% | 11.10% | 4.44% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114563116 | T -> G | LOC_Os01g25679.1 | upstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:11.094; most accessible tissue: Callus, score: 25.996 | N | N | N | N |
| vg0114563116 | T -> G | LOC_Os01g25700.1 | downstream_gene_variant ; 4105.0bp to feature; MODIFIER | silent_mutation | Average:11.094; most accessible tissue: Callus, score: 25.996 | N | N | N | N |
| vg0114563116 | T -> G | LOC_Os01g25688.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.094; most accessible tissue: Callus, score: 25.996 | N | N | N | N |
| vg0114563116 | T -> DEL | N | N | silent_mutation | Average:11.094; most accessible tissue: Callus, score: 25.996 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114563116 | 7.09E-06 | 1.88E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | 9.05E-06 | 9.05E-06 | mr1050_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | NA | 5.53E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | NA | 8.05E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | 5.68E-06 | 5.68E-06 | mr1272_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | NA | 6.44E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | NA | 6.29E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | NA | 3.26E-06 | mr1763_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114563116 | 4.31E-06 | NA | mr1789_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |