Search for Variation information by Variation ID:
Detailed information for vg0114537729:
| Variant ID: vg0114537729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14537729 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GAGGTTGGCGTTTGGAAGGAGAATAAGAGTGGAGCTTCAACTTCTAAGGCTCCTAGGAAGACCAAACTGACCTTTAATATGCTTTTGGAGAAATATGAGA[G/A]
GCAAGGTGGTGAGAAAATTCGCAACAAAGGGAAGAGACCAAGATCACCTCCTAGGGAACGATTTGGTCATTCACCAAGACGGTCGCATTCACCTTCATAT
Reverse complement sequence
ATATGAAGGTGAATGCGACCGTCTTGGTGAATGACCAAATCGTTCCCTAGGAGGTGATCTTGGTCTCTTCCCTTTGTTGCGAATTTTCTCACCACCTTGC[C/T]
TCTCATATTTCTCCAAAAGCATATTAAAGGTCAGTTTGGTCTTCCTAGGAGCCTTAGAAGTTGAAGCTCCACTCTTATTCTCCTTCCAAACGCCAACCTC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 0.20% | 4.87% | 55.71% | NA |
| All Indica | 2759 | 33.00% | 0.10% | 5.98% | 60.96% | NA |
| All Japonica | 1512 | 51.70% | 0.10% | 0.79% | 47.42% | NA |
| Aus | 269 | 24.90% | 0.70% | 15.24% | 59.11% | NA |
| Indica I | 595 | 9.20% | 0.30% | 4.03% | 86.39% | NA |
| Indica II | 465 | 51.40% | 0.00% | 1.51% | 47.10% | NA |
| Indica III | 913 | 38.00% | 0.00% | 8.98% | 53.01% | NA |
| Indica Intermediate | 786 | 34.20% | 0.00% | 6.62% | 59.16% | NA |
| Temperate Japonica | 767 | 83.70% | 0.00% | 0.39% | 15.91% | NA |
| Tropical Japonica | 504 | 9.70% | 0.40% | 1.19% | 88.69% | NA |
| Japonica Intermediate | 241 | 37.30% | 0.00% | 1.24% | 61.41% | NA |
| VI/Aromatic | 96 | 49.00% | 1.00% | 6.25% | 43.75% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 6.67% | 36.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114537729 | G -> A | LOC_Os01g25650.1 | missense_variant ; p.Arg557Lys; MODERATE | nonsynonymous_codon ; R557K | Average:17.543; most accessible tissue: Minghui63 young leaf, score: 32.638 | benign  |
-0.392 |
TOLERATED | 1.00 |
| vg0114537729 | G -> DEL | LOC_Os01g25650.1 | N | frameshift_variant | Average:17.543; most accessible tissue: Minghui63 young leaf, score: 32.638 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114537729 | NA | 1.18E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 3.89E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 3.25E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 5.99E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 4.21E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 9.24E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | 3.18E-06 | 6.59E-07 | mr1583 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 1.13E-06 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 7.17E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114537729 | NA | 7.73E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |