Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114289453:

Variant ID: vg0114289453 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14289453
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCTCTCCTCTACATAAACTTATACTAGGCTTATAGCTCACTATTATAACGGTGGCATGTCTTCGGGTAACATTGTGGGGCATACGATGTACTCAAGGT[G/T]
TGGCGGCATTTGATACCAACAATGGCATCTAAATCTTCAATATAATTTGCTTTAAAGTGAATATGTTATCACCGCAGATAGTTCTTCTATGTTTAGCATG

Reverse complement sequence

CATGCTAAACATAGAAGAACTATCTGCGGTGATAACATATTCACTTTAAAGCAAATTATATTGAAGATTTAGATGCCATTGTTGGTATCAAATGCCGCCA[C/A]
ACCTTGAGTACATCGTATGCCCCACAATGTTACCCGAAGACATGCCACCGTTATAATAGTGAGCTATAAGCCTAGTATAAGTTTATGTAGAGGAGAGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	29.80%	1.29%	34.64%	NA
All Indica	2759	1.80%	44.40%	2.07%	51.76%	NA
All Japonica	1512	97.20%	2.60%	0.00%	0.13%	NA
Aus	269	1.10%	32.30%	0.00%	66.54%	NA
Indica I	595	1.20%	40.80%	1.01%	56.97%	NA
Indica II	465	4.30%	23.00%	1.29%	71.40%	NA
Indica III	913	0.80%	58.90%	3.40%	36.91%	NA
Indica Intermediate	786	2.00%	42.70%	1.78%	53.44%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	44.80%	0.00%	2.08%	NA
Intermediate	90	48.90%	17.80%	4.44%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114289453	G -> T	LOC_Os01g25300.1	upstream_gene_variant ; 920.0bp to feature; MODIFIER	silent_mutation	Average:29.052; most accessible tissue: Callus, score: 91.472	N	N	N	N
vg0114289453	G -> T	LOC_Os01g25290.1	downstream_gene_variant ; 2443.0bp to feature; MODIFIER	silent_mutation	Average:29.052; most accessible tissue: Callus, score: 91.472	N	N	N	N
vg0114289453	G -> T	LOC_Os01g25320.1	downstream_gene_variant ; 2614.0bp to feature; MODIFIER	silent_mutation	Average:29.052; most accessible tissue: Callus, score: 91.472	N	N	N	N
vg0114289453	G -> T	LOC_Os01g25290-LOC_Os01g25300	intergenic_region ; MODIFIER	silent_mutation	Average:29.052; most accessible tissue: Callus, score: 91.472	N	N	N	N
vg0114289453	G -> DEL	N	N	silent_mutation	Average:29.052; most accessible tissue: Callus, score: 91.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114289453	NA	4.47E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	1.27E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	1.81E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	5.67E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	7.18E-06	NA	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	1.44E-07	9.63E-11	mr1193	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	3.45E-06	1.19E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	5.41E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	8.09E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	6.53E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	2.52E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	1.03E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	4.89E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	1.76E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	1.78E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	4.70E-07	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	NA	4.46E-09	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114289453	4.49E-06	2.77E-06	mr1955_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251