Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114251394:

Variant ID: vg0114251394 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14251394
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.22, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TTACGGAGTAGCGTTTAGCAGTCCCTAAGTAAGCTGCTACATATGTTGAGAACCATGATAATCTCAGGTCTAAGGATTCAACACCAACACTAAATGAGAT[T/C,A]
ACTGATGACACAACACATATGACTCTTGCAGTGTCTCATGTTGAGTCTATCCAACAACATGTTCACCAACATGTGTCCACATTATTAATTTGGTATCTCT

Reverse complement sequence

AGAGATACCAAATTAATAATGTGGACACATGTTGGTGAACATGTTGTTGGATAGACTCAACATGAGACACTGCAAGAGTCATATGTGTTGTGTCATCAGT[A/G,T]
ATCTCATTTAGTGTTGGTGTTGAATCCTTAGACCTGAGATTATCATGGTTCTCAACATATGTAGCAGCTTACTTAGGGACTGCTAAACGCTACTCCGTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	30.70%	2.86%	31.78%	NA
All Indica	2759	2.20%	45.90%	3.41%	48.53%	NA
All Japonica	1512	97.20%	2.60%	0.00%	0.13%	NA
Aus	269	3.70%	32.70%	14.13%	49.44%	NA
Indica I	595	1.50%	41.20%	3.36%	53.95%	NA
Indica II	465	4.10%	23.40%	2.80%	69.68%	NA
Indica III	913	0.90%	62.30%	3.40%	33.41%	NA
Indica Intermediate	786	3.10%	43.60%	3.82%	49.49%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.00%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	44.80%	0.00%	2.08%	NA
Intermediate	90	50.00%	17.80%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114251394	T -> A	LOC_Os01g25240.1	upstream_gene_variant ; 1535.0bp to feature; MODIFIER	N	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> A	LOC_Os01g25220.1	downstream_gene_variant ; 3099.0bp to feature; MODIFIER	N	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> A	LOC_Os01g25230.1	intron_variant ; MODIFIER	N	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> DEL	N	N	silent_mutation	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> C	LOC_Os01g25240.1	upstream_gene_variant ; 1535.0bp to feature; MODIFIER	silent_mutation	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> C	LOC_Os01g25220.1	downstream_gene_variant ; 3099.0bp to feature; MODIFIER	silent_mutation	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0114251394	T -> C	LOC_Os01g25230.1	intron_variant ; MODIFIER	silent_mutation	Average:14.404; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114251394	7.42E-06	8.94E-07	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394	2.28E-06	1.54E-06	mr1316	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394	NA	6.63E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114251394	NA	1.21E-08	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251