Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114223167:

Variant ID: vg0114223167 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14223167
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTAATTATGTGAAACATTCTGGGCTGTATTCAAATGGGAGCTGAATCTAATAATTGAGGGTAATTTAGTCATTTGTGCTGAACACTAATTTGTGTGTG[A/G]
TTCCTTAAACGACACCTTTTCTCGGACGGAGGAAGTATTATTTGTTAAAAGATAAATTAATCTTATAGACATACATTTTGTACCAATACAAAATTTGAGT

Reverse complement sequence

ACTCAAATTTTGTATTGGTACAAAATGTATGTCTATAAGATTAATTTATCTTTTAACAAATAATACTTCCTCCGTCCGAGAAAAGGTGTCGTTTAAGGAA[T/C]
CACACACAAATTAGTGTTCAGCACAAATGACTAAATTACCCTCAATTATTAGATTCAGCTCCCATTTGAATACAGCCCAGAATGTTTCACATAATTACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.50%	29.90%	1.12%	34.45%	NA
All Indica	2759	3.10%	43.60%	1.67%	51.65%	NA
All Japonica	1512	95.40%	4.40%	0.00%	0.13%	NA
Aus	269	2.20%	32.30%	1.12%	64.31%	NA
Indica I	595	3.40%	41.70%	1.68%	53.28%	NA
Indica II	465	6.70%	13.50%	1.72%	78.06%	NA
Indica III	913	0.80%	62.00%	0.99%	36.25%	NA
Indica Intermediate	786	3.40%	41.50%	2.42%	52.67%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	89.50%	10.30%	0.00%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	44.80%	0.00%	2.08%	NA
Intermediate	90	52.20%	14.40%	4.44%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114223167	A -> G	LOC_Os01g25170.1	upstream_gene_variant ; 1788.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25189.1	downstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25189.4	downstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25189.5	downstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25189.2	downstream_gene_variant ; 1737.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25189.6	downstream_gene_variant ; 2248.0bp to feature; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> G	LOC_Os01g25170-LOC_Os01g25189	intergenic_region ; MODIFIER	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N
vg0114223167	A -> DEL	N	N	silent_mutation	Average:16.621; most accessible tissue: Callus, score: 41.727	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114223167	NA	1.03E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	4.49E-09	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	4.17E-06	2.02E-06	mr1304	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	7.84E-06	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	5.11E-07	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	7.25E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	2.86E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114223167	NA	6.02E-12	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251