Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114137072:

Variant ID: vg0114137072 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14137072
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCACTAGCGGATCTCACGAATAGGTAAGGGAACATATATTTCTTTCTTCGCAGGTACGCGTATTGTTCATCTCTTTCCTTTTTTTCCGTTTCACTGTTT[T/C]
CGTTTTTTCCGTTTCCACTTTTAAGGTGATTAAGTTTCATTTTTTTTAGTTTCCTCTTTTACGTAACCCATAGTGTTTTTCTGTTTTTTTCACACCGTTT

Reverse complement sequence

AAACGGTGTGAAAAAAACAGAAAAACACTATGGGTTACGTAAAAGAGGAAACTAAAAAAAATGAAACTTAATCACCTTAAAAGTGGAAACGGAAAAAACG[A/G]
AAACAGTGAAACGGAAAAAAAGGAAAGAGATGAACAATACGCGTACCTGCGAAGAAAGAAATATATGTTCCCTTACCTATTCGTGAGATCCGCTAGTGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	10.70%	3.00%	50.06%	NA
All Indica	2759	6.00%	11.30%	4.89%	77.82%	NA
All Japonica	1512	95.20%	0.00%	0.07%	4.70%	NA
Aus	269	3.30%	68.00%	1.49%	27.14%	NA
Indica I	595	2.20%	11.60%	3.53%	82.69%	NA
Indica II	465	18.30%	6.70%	4.09%	70.97%	NA
Indica III	913	2.10%	8.00%	5.70%	84.23%	NA
Indica Intermediate	786	6.10%	17.70%	5.47%	70.74%	NA
Temperate Japonica	767	98.20%	0.00%	0.00%	1.83%	NA
Tropical Japonica	504	89.50%	0.00%	0.00%	10.52%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	52.10%	1.00%	1.04%	45.83%	NA
Intermediate	90	55.60%	8.90%	1.11%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114137072	T -> DEL	N	N	silent_mutation	Average:40.882; most accessible tissue: Callus, score: 84.025	N	N	N	N
vg0114137072	T -> C	LOC_Os01g25060.1	downstream_gene_variant ; 2584.0bp to feature; MODIFIER	silent_mutation	Average:40.882; most accessible tissue: Callus, score: 84.025	N	N	N	N
vg0114137072	T -> C	LOC_Os01g25065.1	downstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:40.882; most accessible tissue: Callus, score: 84.025	N	N	N	N
vg0114137072	T -> C	LOC_Os01g25060-LOC_Os01g25065	intergenic_region ; MODIFIER	silent_mutation	Average:40.882; most accessible tissue: Callus, score: 84.025	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114137072	NA	5.00E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	5.42E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	3.99E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	6.70E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	6.02E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	4.86E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	3.60E-06	NA	mr1528	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	4.41E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114137072	NA	3.32E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251