| Variant ID: vg0114123730 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14123730 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 73. )
CTAAACATCCACAAATTAAGAAGGAAGGTTTTCGACCTCAAATCTTTGATTGGGTTCCATATAAAAGGTGTAGAGCTCGTTCTCCTCCTTCATTTGCTTC[T/C]
ATTTTTTTCAGTTTTCATTGGTGGAATACGAAGAAACTTGTAGTTTTATAAATGGAATAGTGTAGGCACCTTTTTTTTTTATTTTTTTTAGCAAATACAT
ATGTATTTGCTAAAAAAAATAAAAAAAAAAGGTGCCTACACTATTCCATTTATAAAACTACAAGTTTCTTCGTATTCCACCAATGAAAACTGAAAAAAAT[A/G]
GAAGCAAATGAAGGAGGAGAACGAGCTCTACACCTTTTATATGGAACCCAATCAAAGATTTGAGGTCGAAAACCTTCCTTCTTAATTTGTGGATGTTTAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.80% | 13.90% | 0.99% | 50.28% | NA |
| All Indica | 2759 | 3.70% | 23.20% | 1.67% | 71.48% | NA |
| All Japonica | 1512 | 95.30% | 0.00% | 0.00% | 4.70% | NA |
| Aus | 269 | 2.20% | 1.10% | 0.00% | 96.65% | NA |
| Indica I | 595 | 3.90% | 0.50% | 1.34% | 94.29% | NA |
| Indica II | 465 | 5.80% | 55.10% | 2.58% | 36.56% | NA |
| Indica III | 913 | 2.20% | 23.70% | 1.10% | 73.06% | NA |
| Indica Intermediate | 786 | 4.10% | 20.90% | 2.04% | 73.03% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 0.00% | 10.52% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 51.00% | 1.00% | 1.04% | 46.88% | NA |
| Intermediate | 90 | 51.10% | 17.80% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114123730 | T -> DEL | N | N | silent_mutation | Average:18.877; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0114123730 | T -> C | LOC_Os01g25050.1 | downstream_gene_variant ; 4677.0bp to feature; MODIFIER | silent_mutation | Average:18.877; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| vg0114123730 | T -> C | LOC_Os01g25040.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.877; most accessible tissue: Minghui63 young leaf, score: 38.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114123730 | NA | 3.43E-11 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114123730 | 1.07E-06 | 2.22E-15 | Grain_width | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0114123730 | NA | 4.41E-06 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 4.61E-11 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 1.03E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 3.45E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 4.99E-14 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 3.02E-10 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114123730 | NA | 4.25E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |