Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114113018:

Variant ID: vg0114113018 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14113018
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATCCGACACCTAAGAGAGTTTCCTAGTAGTAGTGATACATACTCCCTCCATACTCATAAAAAAAGTCGTTTAGGACATTGACACGGTCTCCAAAACA[C/T]
AATTTTGACTTCTTGTTTCTATAAAAATATTTATTGAAAAATGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAAGTTTT

Reverse complement sequence

AAAACTTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCATTTTTCAATAAATATTTTTATAGAAACAAGAAGTCAAAATT[G/A]
TGTTTTGGAGACCGTGTCAATGTCCTAAACGACTTTTTTTATGAGTATGGAGGGAGTATGTATCACTACTACTAGGAAACTCTCTTAGGTGTCGGATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	21.90%	0.23%	20.12%	NA
All Indica	2759	38.60%	33.60%	0.33%	27.51%	NA
All Japonica	1512	99.70%	0.10%	0.00%	0.13%	NA
Aus	269	3.00%	31.60%	0.37%	65.06%	NA
Indica I	595	17.10%	26.90%	0.34%	55.63%	NA
Indica II	465	63.70%	8.60%	0.22%	27.53%	NA
Indica III	913	41.10%	52.80%	0.11%	6.02%	NA
Indica Intermediate	786	37.00%	31.20%	0.64%	31.17%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	90.60%	8.30%	0.00%	1.04%	NA
Intermediate	90	71.10%	12.20%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114113018	C -> T	LOC_Os01g25020.1	upstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:27.852; most accessible tissue: Callus, score: 44.238	N	N	N	N
vg0114113018	C -> T	LOC_Os01g25010.1	downstream_gene_variant ; 4935.0bp to feature; MODIFIER	silent_mutation	Average:27.852; most accessible tissue: Callus, score: 44.238	N	N	N	N
vg0114113018	C -> T	LOC_Os01g25030.1	downstream_gene_variant ; 3980.0bp to feature; MODIFIER	silent_mutation	Average:27.852; most accessible tissue: Callus, score: 44.238	N	N	N	N
vg0114113018	C -> T	LOC_Os01g25010-LOC_Os01g25020	intergenic_region ; MODIFIER	silent_mutation	Average:27.852; most accessible tissue: Callus, score: 44.238	N	N	N	N
vg0114113018	C -> DEL	N	N	silent_mutation	Average:27.852; most accessible tissue: Callus, score: 44.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114113018	7.40E-06	7.40E-06	mr1483	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	1.75E-06	4.86E-07	mr1634	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	1.38E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	8.56E-08	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	6.97E-06	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	7.83E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	4.60E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114113018	NA	1.48E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251