Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114066007:

Variant ID: vg0114066007 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14066007
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.11, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CCGGCGAGACCTCCACGACGATCGACTTCACCAAGCTTCTACAGACGTACGTCACCGACGAGATCGATCCGTATCTGCTACCTCTACATCATCACCACGA[T/C]
GGTCTTCTCCGACACAACATCGCCGATGGTCTTCTTCAACAAGGGAACACGCCGCCGCCGCTCGTTCACAAGGATGGACATCCCGCGTCCTATGATAGAT

Reverse complement sequence

ATCTATCATAGGACGCGGGATGTCCATCCTTGTGAACGAGCGGCGGCGGCGTGTTCCCTTGTTGAAGAAGACCATCGGCGATGTTGTGTCGGAGAAGACC[A/G]
TCGTGGTGATGATGTAGAGGTAGCAGATACGGATCGATCTCGTCGGTGACGTACGTCTGTAGAAGCTTGGTGAAGTCGATCGTCGTGGAGGTCTCGCCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 29.60% 0.89% 13.42% NA
All Indica  2759 36.00% 40.00% 1.49% 22.51% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.13% NA
Aus  269 1.50% 97.40% 0.37% 0.74% NA
Indica I  595 16.50% 32.30% 3.03% 48.24% NA
Indica II  465 54.20% 9.00% 2.37% 34.41% NA
Indica III  913 40.50% 57.90% 0.00% 1.53% NA
Indica Intermediate  786 34.70% 43.40% 1.53% 20.36% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 67.80% 22.20% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114066007 T -> DEL N N silent_mutation Average:89.617; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0114066007 T -> C LOC_Os01g24950.1 downstream_gene_variant ; 1600.0bp to feature; MODIFIER silent_mutation Average:89.617; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0114066007 T -> C LOC_Os01g24960.1 downstream_gene_variant ; 2127.0bp to feature; MODIFIER silent_mutation Average:89.617; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0114066007 T -> C LOC_Os01g24950.2 downstream_gene_variant ; 1102.0bp to feature; MODIFIER silent_mutation Average:89.617; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N
vg0114066007 T -> C LOC_Os01g24950-LOC_Os01g24960 intergenic_region ; MODIFIER silent_mutation Average:89.617; most accessible tissue: Minghui63 panicle, score: 95.083 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0114066007 T C 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114066007 NA 6.44E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 8.01E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 2.50E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 5.97E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 2.58E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 2.23E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 1.87E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 1.94E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 1.88E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 2.16E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 7.89E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 3.72E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 5.74E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 8.59E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 8.64E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 4.51E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 5.37E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 7.77E-10 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 4.33E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 1.40E-15 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 2.76E-09 mr1803_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 9.26E-25 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 1.92E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114066007 NA 6.32E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251