Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114056307:

Variant ID: vg0114056307 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14056307
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCTTGCACACTAACACCTTCTTCCAGCAACTTCAAGATGAGGGCGAGCTTGGAGAATCCATGGGGATGCCTAGGGTGCAAGCCGCATTGCGCTGCCTC[T/C]
CGCCGCTAATCCGATCGCACTGTACCACCGCTAACCCCGCTGCACTGCGCTGCCTCCTGTCGCTAATCTCACCACCGAGGCCGCCAAAGCCGCTACCTCT

Reverse complement sequence

AGAGGTAGCGGCTTTGGCGGCCTCGGTGGTGAGATTAGCGACAGGAGGCAGCGCAGTGCAGCGGGGTTAGCGGTGGTACAGTGCGATCGGATTAGCGGCG[A/G]
GAGGCAGCGCAATGCGGCTTGCACCCTAGGCATCCCCATGGATTCTCCAAGCTCGCCCTCATCTTGAAGTTGCTGGAAGAAGGTGTTAGTGTGCAAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	33.10%	0.51%	14.24%	NA
All Indica	2759	74.00%	1.30%	0.87%	23.89%	NA
All Japonica	1512	4.80%	95.10%	0.00%	0.13%	NA
Aus	269	98.10%	0.70%	0.00%	1.12%	NA
Indica I	595	46.90%	0.70%	1.18%	51.26%	NA
Indica II	465	58.50%	3.00%	1.51%	36.99%	NA
Indica III	913	98.00%	0.30%	0.00%	1.64%	NA
Indica Intermediate	786	75.70%	1.80%	1.27%	21.25%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	10.70%	89.10%	0.00%	0.20%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	45.60%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114056307	T -> DEL	N	N	silent_mutation	Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0114056307	T -> C	LOC_Os01g24950.1	upstream_gene_variant ; 3265.0bp to feature; MODIFIER	silent_mutation	Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0114056307	T -> C	LOC_Os01g24950.2	upstream_gene_variant ; 3292.0bp to feature; MODIFIER	silent_mutation	Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0114056307	T -> C	LOC_Os01g24940.1	downstream_gene_variant ; 1397.0bp to feature; MODIFIER	silent_mutation	Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N
vg0114056307	T -> C	LOC_Os01g24940-LOC_Os01g24950	intergenic_region ; MODIFIER	silent_mutation	Average:61.935; most accessible tissue: Zhenshan97 young leaf, score: 79.507	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114056307	NA	2.36E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	4.53E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	1.87E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	6.56E-06	8.22E-06	mr1637	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	3.52E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	5.31E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	1.43E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114056307	NA	3.45E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251