Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114041371:

Variant ID: vg0114041371 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14041371
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATACTGATTCAGACTGTCAAGGTGAGGTACTACCCTAGTCTAATTGTACATAGATTGGATCTGTGTGTGCATAATATAGCGTGTGAATAGCACGTAGCA[T/C]
GTATGAAGAAATCGATCAATCACCCCTATTAGGTTTTAGGGGTGACCGGGTAAGGTTGGTAGGTTGTCCCTTATAATCTAGGTACCTACCACCTATTTAC

Reverse complement sequence

GTAAATAGGTGGTAGGTACCTAGATTATAAGGGACAACCTACCAACCTTACCCGGTCACCCCTAAAACCTAATAGGGGTGATTGATCGATTTCTTCATAC[A/G]
TGCTACGTGCTATTCACACGCTATATTATGCACACACAGATCCAATCTATGTACAATTAGACTAGGGTAGTACCTCACCTTGACAGTCTGAATCAGTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	48.10%	0.13%	0.00%	NA
All Indica	2759	73.20%	26.60%	0.22%	0.00%	NA
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	45.70%	53.80%	0.50%	0.00%	NA
Indica II	465	56.80%	42.80%	0.43%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	75.10%	24.80%	0.13%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114041371	T -> C	LOC_Os01g24920.1	downstream_gene_variant ; 2583.0bp to feature; MODIFIER	silent_mutation	Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0114041371	T -> C	LOC_Os01g24930.1	downstream_gene_variant ; 1718.0bp to feature; MODIFIER	silent_mutation	Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0114041371	T -> C	LOC_Os01g24920-LOC_Os01g24930	intergenic_region ; MODIFIER	silent_mutation	Average:61.21; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114041371	NA	5.72E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	2.83E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	2.86E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	4.96E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	6.37E-06	6.37E-06	mr1483	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	3.16E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	6.15E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	6.13E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	5.13E-06	mr1586	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	2.07E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	5.45E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	2.48E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	3.95E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114041371	NA	1.56E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251