Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113942268:

Variant ID: vg0113942268 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13942268
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAACAACCTATCATAATATGAAACTCTTTTTATTTAAAACATCATAATTTTATAGATATTATTAGTCAAAGTAGCATCTCGGAGACTGTGTCAGAATC[C/T,A]
AAAAATACTTATATTTTAGGACAGATAAAGTAATTCTAGCTCGATCAACTGCGTGTTGTGTGTTACTGTCTTCTTCAAACCACGTAATTAGTCTTCTTTC

Reverse complement sequence

GAAAGAAGACTAATTACGTGGTTTGAAGAAGACAGTAACACACAACACGCAGTTGATCGAGCTAGAATTACTTTATCTGTCCTAAAATATAAGTATTTTT[G/A,T]
GATTCTGACACAGTCTCCGAGATGCTACTTTGACTAATAATATCTATAAAATTATGATGTTTTAAATAAAAAGAGTTTCATATTATGATAGGTTGTTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	9.90%	0.17%	7.85%	A: 0.02%
All Indica	2759	77.70%	15.30%	0.25%	6.71%	NA
All Japonica	1512	97.40%	2.60%	0.00%	0.00%	NA
Aus	269	33.10%	0.00%	0.37%	66.17%	A: 0.37%
Indica I	595	78.80%	16.50%	0.50%	4.20%	NA
Indica II	465	95.70%	4.10%	0.00%	0.22%	NA
Indica III	913	71.20%	20.30%	0.22%	8.32%	NA
Indica Intermediate	786	73.90%	15.30%	0.25%	10.56%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	86.70%	5.60%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113942268	C -> T	LOC_Os01g24770.1	upstream_gene_variant ; 4966.0bp to feature; MODIFIER	silent_mutation	Average:43.527; most accessible tissue: Callus, score: 73.374	N	N	N	N
vg0113942268	C -> T	LOC_Os01g24780.1	intron_variant ; MODIFIER	silent_mutation	Average:43.527; most accessible tissue: Callus, score: 73.374	N	N	N	N
vg0113942268	C -> A	LOC_Os01g24770.1	upstream_gene_variant ; 4966.0bp to feature; MODIFIER	silent_mutation	Average:43.527; most accessible tissue: Callus, score: 73.374	N	N	N	N
vg0113942268	C -> A	LOC_Os01g24780.1	intron_variant ; MODIFIER	silent_mutation	Average:43.527; most accessible tissue: Callus, score: 73.374	N	N	N	N
vg0113942268	C -> DEL	N	N	silent_mutation	Average:43.527; most accessible tissue: Callus, score: 73.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113942268	8.22E-07	2.78E-10	mr1064	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	1.38E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	2.63E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	3.87E-08	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	1.97E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	4.87E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	8.42E-06	3.74E-08	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113942268	NA	1.95E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251