| Variant ID: vg0113806881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13806881 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 76. )
ACCGGGAGCTGGTGCACCGATCGACAACACCAACGGAGGCAGTTCTGCCTCACAATCCAGCGGTGGGACTTTCACAGAGTATAACCCTCTACTGTTATTT[C/T]
GGTTTTTGATATTTCTGTTAGTCGCAATGCTATTGCGTTCTATGTATGATGATGATGCTTATTCTACCTTAAGCATGCTGCTGTTTATGTTTGATTTTAT
ATAAAATCAAACATAAACAGCAGCATGCTTAAGGTAGAATAAGCATCATCATCATACATAGAACGCAATAGCATTGCGACTAACAGAAATATCAAAAACC[G/A]
AAATAACAGTAGAGGGTTATACTCTGTGAAAGTCCCACCGCTGGATTGTGAGGCAGAACTGCCTCCGTTGGTGTTGTCGATCGGTGCACCAGCTCCCGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 5.20% | 1.61% | 43.57% | NA |
| All Indica | 2759 | 20.30% | 7.20% | 2.43% | 70.06% | NA |
| All Japonica | 1512 | 94.50% | 2.80% | 0.26% | 2.38% | NA |
| Aus | 269 | 91.10% | 0.00% | 0.37% | 8.55% | NA |
| Indica I | 595 | 9.90% | 17.30% | 2.02% | 70.76% | NA |
| Indica II | 465 | 6.90% | 1.10% | 2.58% | 89.46% | NA |
| Indica III | 913 | 32.90% | 0.80% | 1.86% | 64.51% | NA |
| Indica Intermediate | 786 | 21.40% | 10.80% | 3.31% | 64.50% | NA |
| Temperate Japonica | 767 | 97.00% | 1.80% | 0.26% | 0.91% | NA |
| Tropical Japonica | 504 | 89.90% | 5.00% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 96.30% | 1.70% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 1.04% | 37.50% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 3.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113806881 | C -> T | LOC_Os01g24480.1 | upstream_gene_variant ; 2091.0bp to feature; MODIFIER | silent_mutation | Average:6.556; most accessible tissue: Callus, score: 18.227 | N | N | N | N |
| vg0113806881 | C -> T | LOC_Os01g24490.1 | downstream_gene_variant ; 642.0bp to feature; MODIFIER | silent_mutation | Average:6.556; most accessible tissue: Callus, score: 18.227 | N | N | N | N |
| vg0113806881 | C -> T | LOC_Os01g24480-LOC_Os01g24490 | intergenic_region ; MODIFIER | silent_mutation | Average:6.556; most accessible tissue: Callus, score: 18.227 | N | N | N | N |
| vg0113806881 | C -> DEL | N | N | silent_mutation | Average:6.556; most accessible tissue: Callus, score: 18.227 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113806881 | NA | 4.69E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | NA | 1.42E-06 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | NA | 3.83E-06 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | 3.12E-06 | 3.12E-06 | mr1270 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | 9.24E-06 | 3.00E-07 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | NA | 2.67E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | NA | 1.05E-07 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113806881 | NA | 7.45E-06 | mr1952 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |