Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113805813:

Variant ID: vg0113805813 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13805813
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.29, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGGATGCAAACGGCAGCCCAGTACCAATCAAGGGTTTGAGTGAAACCTGATCACATAAGACTGACAATTCAAGGCATAGTCCATTGTTTAGTTGTGGT[T/C]
TGATGTAGCTCATTTCCTAGGTGGAAGTTCAACTTAACAGTCTCCACCAAAACACTGGTATATCAAACAGGCACAACTTTGAGAACATTTCTTATGAGCC

Reverse complement sequence

GGCTCATAAGAAATGTTCTCAAAGTTGTGCCTGTTTGATATACCAGTGTTTTGGTGGAGACTGTTAAGTTGAACTTCCACCTAGGAAATGAGCTACATCA[A/G]
ACCACAACTAAACAATGGACTATGCCTTGAATTGTCAGTCTTATGTGATCAGGTTTCACTCAAACCCTTGATTGGTACTGGGCTGCCGTTTGCATCCCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.00%	17.70%	10.52%	35.76%	NA
All Indica	2759	6.90%	19.80%	15.98%	57.34%	NA
All Japonica	1512	94.60%	2.80%	0.79%	1.72%	NA
Aus	269	3.70%	88.10%	2.60%	5.58%	NA
Indica I	595	6.90%	22.00%	17.65%	53.45%	NA
Indica II	465	6.50%	1.90%	24.30%	67.31%	NA
Indica III	913	8.00%	23.00%	11.94%	57.06%	NA
Indica Intermediate	786	5.70%	25.10%	14.50%	54.71%	NA
Temperate Japonica	767	97.00%	1.80%	0.13%	1.04%	NA
Tropical Japonica	504	89.70%	5.20%	2.18%	2.98%	NA
Japonica Intermediate	241	97.50%	1.20%	0.00%	1.24%	NA
VI/Aromatic	96	29.20%	1.00%	30.21%	39.58%	NA
Intermediate	90	47.80%	11.10%	8.89%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113805813	T -> DEL	N	N	silent_mutation	Average:8.483; most accessible tissue: Callus, score: 15.676	N	N	N	N
vg0113805813	T -> C	LOC_Os01g24480.1	upstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:8.483; most accessible tissue: Callus, score: 15.676	N	N	N	N
vg0113805813	T -> C	LOC_Os01g24490.1	downstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:8.483; most accessible tissue: Callus, score: 15.676	N	N	N	N
vg0113805813	T -> C	LOC_Os01g24480-LOC_Os01g24490	intergenic_region ; MODIFIER	silent_mutation	Average:8.483; most accessible tissue: Callus, score: 15.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113805813	NA	2.74E-09	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	3.05E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	9.14E-10	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	3.05E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	1.13E-09	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	2.78E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	5.30E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	8.05E-07	8.78E-06	mr1749	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	4.05E-06	mr1749	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113805813	NA	8.66E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251