Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113770672:

Variant ID: vg0113770672 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13770672
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CATAATGCAGATGCATAGAATACTTATTGTTTGTTAGATGGATCACAATATGAAGATTCCAAAGATGTTCCCCTCTAGCTTTACTTTGCCAAAAAAATTT[A/G]
GCTAAGAAAAGAAAGACAATGACATAAACGATAAACCATACTACAATTTAGTATCTGCAAAGTTCAGGAACCAATGGCACTATCCAGCGCACTATATTTC

Reverse complement sequence

GAAATATAGTGCGCTGGATAGTGCCATTGGTTCCTGAACTTTGCAGATACTAAATTGTAGTATGGTTTATCGTTTATGTCATTGTCTTTCTTTTCTTAGC[T/C]
AAATTTTTTTGGCAAAGTAAAGCTAGAGGGGAACATCTTTGGAATCTTCATATTGTGATCCATCTAACAAACAATAAGTATTCTATGCATCTGCATTATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 29.20% 0.74% 4.42% NA
All Indica  2759 43.90% 48.90% 0.62% 6.56% NA
All Japonica  1512 98.40% 0.10% 0.53% 0.93% NA
Aus  269 97.00% 2.20% 0.37% 0.37% NA
Indica I  595 41.30% 47.60% 1.34% 9.75% NA
Indica II  465 20.00% 72.00% 0.22% 7.74% NA
Indica III  913 53.00% 40.60% 0.33% 6.02% NA
Indica Intermediate  786 49.50% 45.80% 0.64% 4.07% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 0.20% 1.39% 2.58% NA
Japonica Intermediate  241 98.80% 0.40% 0.41% 0.41% NA
VI/Aromatic  96 81.20% 1.00% 9.38% 8.33% NA
Intermediate  90 67.80% 26.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113770672 A -> G LOC_Os01g24430.1 upstream_gene_variant ; 4514.0bp to feature; MODIFIER silent_mutation Average:80.187; most accessible tissue: Zhenshan97 root, score: 93.917 N N N N
vg0113770672 A -> G LOC_Os01g24420.1 intron_variant ; MODIFIER silent_mutation Average:80.187; most accessible tissue: Zhenshan97 root, score: 93.917 N N N N
vg0113770672 A -> DEL N N silent_mutation Average:80.187; most accessible tissue: Zhenshan97 root, score: 93.917 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113770672 A G 0.01 0.0 0.0 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113770672 NA 1.87E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 1.65E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 6.47E-06 6.44E-06 mr1429 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 2.63E-06 5.33E-06 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 5.08E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 1.67E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 2.46E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 1.94E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 9.62E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113770672 NA 4.26E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251