Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113762419:

Variant ID: vg0113762419 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 13762419
Reference Allele: T	Alternative Allele: TTA,A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCACAGAGGGAGAAGGATGTGCTAAGACAGGCGCTGGGGAATCGGGAGCATGGAGGCCGGGTTCGAGGCGTATCCTCTAAGCTGAGTTGGAAAGAAGG[T/TTA,A]
TTCAAACAGGACGCCTCCTCATACAAGAAATGTGACGCCTATAAGGACAAGTTGAGGGACGAAGGGGGTAAGCAGTTTGAAAAAGAATTGATTGATTTCT

Reverse complement sequence

AGAAATCAATCAATTCTTTTTCAAACTGCTTACCCCCTTCGTCCCTCAACTTGTCCTTATAGGCGTCACATTTCTTGTATGAGGAGGCGTCCTGTTTGAA[A/TAA,T]
CCTTCTTTCCAACTCAGCTTAGAGGATACGCCTCGAACCCGGCCTCCATGCTCCCGATTCCCCAGCGCCTGTCTTAGCACATCCTTCTCCCTCTGTGGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.80%	12.30%	2.69%	34.85%	TTA: 2.39%
All Indica	2759	26.70%	11.90%	4.24%	54.15%	TTA: 3.04%
All Japonica	1512	95.10%	0.30%	0.33%	2.38%	TTA: 1.92%
Aus	269	2.20%	88.10%	0.00%	9.67%	NA
Indica I	595	31.30%	6.70%	5.04%	46.05%	TTA: 10.92%
Indica II	465	19.80%	12.30%	3.23%	63.87%	TTA: 0.86%
Indica III	913	26.40%	13.30%	1.86%	58.49%	NA
Indica Intermediate	786	27.60%	14.00%	7.00%	49.49%	TTA: 1.91%
Temperate Japonica	767	98.60%	0.00%	0.39%	0.26%	TTA: 0.78%
Tropical Japonica	504	88.90%	0.80%	0.40%	5.95%	TTA: 3.97%
Japonica Intermediate	241	97.10%	0.00%	0.00%	1.66%	TTA: 1.24%
VI/Aromatic	96	29.20%	3.10%	3.12%	64.58%	NA
Intermediate	90	55.60%	10.00%	2.22%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113762419	T -> A	LOC_Os01g24410.1	synonymous_variant ; p.Gly177Gly; LOW	synonymous_codon	Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0113762419	T -> TTA	LOC_Os01g24410.1	frameshift_variant ; p.Phe178fs; HIGH	frameshift_variant	Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0113762419	T -> DEL	LOC_Os01g24410.1	N	frameshift_variant	Average:22.446; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113762419	NA	2.68E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	2.26E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	2.01E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	1.26E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	4.19E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	5.58E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	3.35E-06	3.36E-06	mr1674	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113762419	NA	1.00E-05	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251