Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113723567:

Variant ID: vg0113723567 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13723567
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCAGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTC[C/T]
GGGCGTGACACCTTTCACGAAATTGGTGTAATTTTGCTACTTTATCTCTTTTGTGCCTCCACCACATCTGTCACCGCCGAGACCGAAGGAAGGGGAAAAA

Reverse complement sequence

TTTTTCCCCTTCCTTCGGTCTCGGCGGTGACAGATGTGGTGGAGGCACAAAAGAGATAAAGTAGCAAAATTACACCAATTTCGTGAAAGGTGTCACGCCC[G/A]
GAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCTGAGGCACACAATAACAAATTGATAATAGAGTACAATTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	0.60%	3.20%	14.30%	NA
All Indica	2759	73.90%	0.10%	4.64%	21.35%	NA
All Japonica	1512	95.70%	1.50%	1.19%	1.59%	NA
Aus	269	98.50%	0.40%	0.37%	0.74%	NA
Indica I	595	70.40%	0.20%	6.05%	23.36%	NA
Indica II	465	55.70%	0.00%	3.01%	41.29%	NA
Indica III	913	83.40%	0.10%	4.82%	11.72%	NA
Indica Intermediate	786	76.50%	0.00%	4.33%	19.21%	NA
Temperate Japonica	767	96.50%	2.20%	1.30%	0.00%	NA
Tropical Japonica	504	95.20%	0.00%	0.40%	4.37%	NA
Japonica Intermediate	241	94.20%	2.50%	2.49%	0.83%	NA
VI/Aromatic	96	47.90%	1.00%	4.17%	46.88%	NA
Intermediate	90	82.20%	0.00%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113723567	C -> T	LOC_Os01g24350.1	downstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:19.726; most accessible tissue: Callus, score: 40.769	N	N	N	N
vg0113723567	C -> T	LOC_Os01g24360.1	downstream_gene_variant ; 3195.0bp to feature; MODIFIER	silent_mutation	Average:19.726; most accessible tissue: Callus, score: 40.769	N	N	N	N
vg0113723567	C -> T	LOC_Os01g24350-LOC_Os01g24360	intergenic_region ; MODIFIER	silent_mutation	Average:19.726; most accessible tissue: Callus, score: 40.769	N	N	N	N
vg0113723567	C -> DEL	N	N	silent_mutation	Average:19.726; most accessible tissue: Callus, score: 40.769	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113723567	NA	3.05E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	4.44E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	6.10E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	2.40E-07	NA	mr1754	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	2.73E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	8.59E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	1.61E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	9.05E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	8.55E-06	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567	NA	2.30E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251