Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113681497:

Variant ID: vg0113681497 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13681497
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCCGCGTCTCACCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGTTCGCCTCCGTCGTCCCCGAGCCGTCTCCGCCGCGCTCCTTCGTCGT[T/C]
GTCGTTCCCACGCCTCGTCGCGTGGTGGTAAGGATCTCTCCCTCGTCGCCCTTGTCCTCGTCCTTTTGGTGTCACCCCGTACCCGTTGTGCGGCTGTCGA

Reverse complement sequence

TCGACAGCCGCACAACGGGTACGGGGTGACACCAAAAGGACGAGGACAAGGGCGACGAGGGAGAGATCCTTACCACCACGCGACGAGGCGTGGGAACGAC[A/G]
ACGACGAAGGAGCGCGGCGGAGACGGCTCGGGGACGACGGAGGCGAACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGTGAGACGCGGCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	23.00%	27.66%	6.62%	NA
All Indica	2759	20.90%	36.60%	39.14%	3.30%	NA
All Japonica	1512	85.10%	0.60%	3.57%	10.71%	NA
Aus	269	29.40%	18.60%	51.67%	0.37%	NA
Indica I	595	19.70%	27.60%	42.35%	10.42%	NA
Indica II	465	13.10%	43.90%	40.86%	2.15%	NA
Indica III	913	27.70%	41.00%	31.33%	0.00%	NA
Indica Intermediate	786	18.70%	34.10%	44.78%	2.42%	NA
Temperate Japonica	767	97.00%	0.40%	1.43%	1.17%	NA
Tropical Japonica	504	63.70%	1.20%	7.34%	27.78%	NA
Japonica Intermediate	241	92.10%	0.00%	2.49%	5.39%	NA
VI/Aromatic	96	31.20%	6.20%	8.33%	54.17%	NA
Intermediate	90	51.10%	12.20%	28.89%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113681497	T -> DEL	N	N	silent_mutation	Average:15.519; most accessible tissue: Callus, score: 42.613	N	N	N	N
vg0113681497	T -> C	LOC_Os01g24280.1	downstream_gene_variant ; 2436.0bp to feature; MODIFIER	silent_mutation	Average:15.519; most accessible tissue: Callus, score: 42.613	N	N	N	N
vg0113681497	T -> C	LOC_Os01g24294.1	downstream_gene_variant ; 2885.0bp to feature; MODIFIER	silent_mutation	Average:15.519; most accessible tissue: Callus, score: 42.613	N	N	N	N
vg0113681497	T -> C	LOC_Os01g24280-LOC_Os01g24294	intergenic_region ; MODIFIER	silent_mutation	Average:15.519; most accessible tissue: Callus, score: 42.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113681497	8.11E-07	8.11E-07	mr1601	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113681497	NA	3.06E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113681497	NA	5.92E-29	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251