Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113615961:

Variant ID: vg0113615961 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13615961
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

TTATGTACAATTACCATTTGTAGGGTAAAATTTACAGTTTTTTTATATTTTAAAAGTTTATTTAAAAGAGGTTTCAAAATTTTGTAGCAATTTTTTATGT[G/A]
CACTTACCATTGTTTGAAAACTATTTAAAAAATTAAAAGTAGTAATATTAATGTTTCAAACATTTAAGTAAGATTTACATTTGAATAGTACTAATATTAA

Reverse complement sequence

TTAATATTAGTACTATTCAAATGTAAATCTTACTTAAATGTTTGAAACATTAATATTACTACTTTTAATTTTTTAAATAGTTTTCAAACAATGGTAAGTG[C/T]
ACATAAAAAATTGCTACAAAATTTTGAAACCTCTTTTAAATAAACTTTTAAAATATAAAAAAACTGTAAATTTTACCCTACAAATGGTAATTGTACATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.10%	2.40%	4.49%	43.99%	NA
All Indica	2759	31.50%	3.20%	4.93%	60.35%	NA
All Japonica	1512	88.00%	0.80%	2.71%	8.53%	NA
Aus	269	15.20%	2.20%	5.58%	76.95%	NA
Indica I	595	55.10%	0.30%	2.02%	42.52%	NA
Indica II	465	18.90%	0.40%	3.23%	77.42%	NA
Indica III	913	24.00%	5.80%	8.65%	61.56%	NA
Indica Intermediate	786	29.90%	3.90%	3.82%	62.34%	NA
Temperate Japonica	767	99.00%	0.00%	0.13%	0.91%	NA
Tropical Japonica	504	68.80%	2.00%	7.34%	21.83%	NA
Japonica Intermediate	241	92.90%	0.80%	1.24%	4.98%	NA
VI/Aromatic	96	30.20%	3.10%	18.75%	47.92%	NA
Intermediate	90	57.80%	4.40%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113615961	G -> A	LOC_Os01g24150.1	upstream_gene_variant ; 1547.0bp to feature; MODIFIER	silent_mutation	Average:23.705; most accessible tissue: Callus, score: 37.458	N	N	N	N
vg0113615961	G -> A	LOC_Os01g24140.1	downstream_gene_variant ; 933.0bp to feature; MODIFIER	silent_mutation	Average:23.705; most accessible tissue: Callus, score: 37.458	N	N	N	N
vg0113615961	G -> A	LOC_Os01g24140-LOC_Os01g24150	intergenic_region ; MODIFIER	silent_mutation	Average:23.705; most accessible tissue: Callus, score: 37.458	N	N	N	N
vg0113615961	G -> DEL	N	N	silent_mutation	Average:23.705; most accessible tissue: Callus, score: 37.458	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113615961	8.27E-06	8.66E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	4.69E-06	4.69E-06	mr1529	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	NA	7.88E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	NA	7.29E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	NA	5.84E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	9.67E-06	8.80E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	NA	2.58E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615961	NA	7.55E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251