Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113583492:

Variant ID: vg0113583492 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13583492
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAGAAGAATATTAGAAATTTGTACATGTAGGACGCGTTATGTCGTATGCATAGAAAATTTTAAGAAATTTATAAATGTGGTCATCATCAAGTGAGTA[C/T]
GGACGCCCAATAGCACTGTATTCGTTTAGTACTCTGCCAGCTGATCTCAGCTTAAGACACTTTTAGTCAATTGATAATTTGAATTTGTTATGTACTGCAG

Reverse complement sequence

CTGCAGTACATAACAAATTCAAATTATCAATTGACTAAAAGTGTCTTAAGCTGAGATCAGCTGGCAGAGTACTAAACGAATACAGTGCTATTGGGCGTCC[G/A]
TACTCACTTGATGATGACCACATTTATAAATTTCTTAAAATTTTCTATGCATACGACATAACGCGTCCTACATGTACAAATTTCTAATATTCTTCTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	4.90%	0.57%	0.53%	NA
All Indica	2759	92.40%	6.90%	0.58%	0.18%	NA
All Japonica	1512	96.10%	2.70%	0.46%	0.73%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.20%	16.80%	0.00%	0.00%	NA
Indica II	465	98.30%	0.90%	0.43%	0.43%	NA
Indica III	913	98.10%	0.40%	1.10%	0.33%	NA
Indica Intermediate	786	89.20%	10.30%	0.51%	0.00%	NA
Temperate Japonica	767	98.20%	1.70%	0.13%	0.00%	NA
Tropical Japonica	504	91.90%	5.00%	1.19%	1.98%	NA
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.41%	NA
VI/Aromatic	96	88.50%	0.00%	3.12%	8.33%	NA
Intermediate	90	96.70%	1.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113583492	C -> T	LOC_Os01g24080.1	downstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0113583492	C -> T	LOC_Os01g24090.1	intron_variant ; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0113583492	C -> T	LOC_Os01g24090.2	intron_variant ; MODIFIER	silent_mutation	Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0113583492	C -> DEL	N	N	silent_mutation	Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113583492	NA	2.44E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492	NA	4.44E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492	NA	3.26E-07	mr1316	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492	NA	7.21E-07	mr1716	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492	NA	4.20E-07	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251