Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113575626:

Variant ID: vg0113575626 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13575626
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTAAATCTCTAAAATTTAATAAATTATTAAATTATAGATAATATAGCATACTTGTATGATGCTTAAATGTAATAATTATTAGTGGATAATGATGTG[G/A]
CATCTTTGCATGTTAAGCTTTAAAAATTAGTGAGTATAACTTTGTACTAAGAGAGTTGTATGGGTAAGCTATTAAAGTGATTGTATATGGTGTGTCAATT

Reverse complement sequence

AATTGACACACCATATACAATCACTTTAATAGCTTACCCATACAACTCTCTTAGTACAAAGTTATACTCACTAATTTTTAAAGCTTAACATGCAAAGATG[C/T]
CACATCATTATCCACTAATAATTATTACATTTAAGCATCATACAAGTATGCTATATTATCTATAATTTAATAATTTATTAAATTTTAGAGATTTAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	16.20%	1.69%	0.00%	NA
All Indica	2759	74.20%	24.90%	0.87%	0.00%	NA
All Japonica	1512	97.70%	0.20%	2.12%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	72.60%	27.40%	0.00%	0.00%	NA
Indica II	465	88.00%	9.90%	2.15%	0.00%	NA
Indica III	913	67.30%	32.20%	0.55%	0.00%	NA
Indica Intermediate	786	75.30%	23.50%	1.15%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	93.80%	0.40%	5.75%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	32.30%	47.90%	19.79%	0.00%	NA
Intermediate	90	85.60%	8.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113575626	G -> A	LOC_Os01g24080.1	upstream_gene_variant ; 2325.0bp to feature; MODIFIER	silent_mutation	Average:58.154; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0113575626	G -> A	LOC_Os01g24070.1	downstream_gene_variant ; 2304.0bp to feature; MODIFIER	silent_mutation	Average:58.154; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0113575626	G -> A	LOC_Os01g24070.2	downstream_gene_variant ; 2501.0bp to feature; MODIFIER	silent_mutation	Average:58.154; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N
vg0113575626	G -> A	LOC_Os01g24070-LOC_Os01g24080	intergenic_region ; MODIFIER	silent_mutation	Average:58.154; most accessible tissue: Minghui63 flower, score: 65.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113575626	NA	9.36E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113575626	NA	1.98E-08	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113575626	NA	8.16E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113575626	7.42E-07	NA	mr1871_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113575626	NA	4.96E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251